Mutants (Isolated)

tm911

Allele Nametm911
Sequence NameZC513.6
CGC Nameoma-2
Worm BaseAllele Name tm911
CGC Name oma-2
Sequence ZC513.6
Phenotypehomozygous viable
Mutation site2074/2075-TATTATTTCTTGCAGGGTCCAACCCCAGTTAGCATTC-2770/2771 (696 bp deletion + 37 bp insertion)
ChromosomeV
Putative gene structurejoin(1876..1913, 1962..2117, 2166..2387, 2432..2579, 2625..2841, 2887..3287)
Map position1.02
Balancer
Map position of balancer
Sequence of primersIntFwd:TTAGCGCGCATTGCCGCCAA,ExtFwd:AGCGGGGAGTGCACATCTCA,IntRev:CGCCCTGTCGCGAAACTAAT,ExtRev:GGACGAAGCAAATGCGCCCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Shimada M, Kanematsu K, Tanaka K, Yokosawa H, Kawahara H.
Proteasomal ubiquitin receptor RPN-10 controls sex determination in Caenorhabditis elegans.
Mol. Biol. Cell 2006 17(12) 5356-71 
[ PubMed ID = 17050737 ] [ RRC reference ]