Mutants (Isolated)

tm903

Allele Nametm903
Sequence NameT23G5.5
CGC Namedat-1
Worm BaseAllele Name tm903
CGC Name dat-1
Sequence T23G5.5
Phenotypehomozygous viable. Dr. G. Jansen: WT avoidance of 0.5 M NaCl and WT chemotaxis to NaCl. Dr. L. Avery: Feeding and satiety behavior normal.
Mutation site24428/24429-24968/24969 (540 bp deletion)
ChromosomeIII
Putative gene structurejoin(23832..23850, 24227..24345, 24394..24713, 25029..25178, 25230..25323, 25373..25567, 25612..25724, 25772..26009, 26052..26180, 26225..26324, 26366..26466, 26724..26894, Z19156.1:464..562)
Map position0.36
Balancer
Map position of balancer
Sequence of primersExtRev:GCTCCAGCAAAACTTCCAAT,IntRev:GCGGAATCCCATCATCTCTT,ExtFwd:AAATCGGTCGGACGTCTAAT,IntFwd:GGCATGCAAAATGCAACTCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wang J, Farr GW, Hall DH, Li F, Furtak K, Dreier L, Horwich AL.
An ALS-linked mutant SOD1 produces a locomotor defect associated with aggregation and synaptic dysfunction when expressed in neurons of Caenorhabditis elegans.
PLoS Genet. 2009 5(1) e1000350 
[ PubMed ID = 19165329 ] [ RRC reference ]

Voglis G, Tavernarakis N.
A synaptic DEG/ENaC ion channel mediates learning in C. elegans by facilitating dopamine signalling.
EMBO J. 2008 27(24) 3288-99 
[ PubMed ID = 19037257 ] [ RRC reference ]

Ward A, Walker VJ, Feng Z, Xu XZ.
Cocaine modulates locomotion behavior in C. elegans.
PLoS ONE 2009 4(6) e5946 
[ PubMed ID = 19536276 ] [ RRC reference ]

You YJ, Kim J, Raizen DM, Avery L.
Insulin, cGMP, and TGF-beta signals regulate food intake and quiescence in C. elegans: a model for satiety.
Cell Metab. 2008 7(3) 249-57 
[ PubMed ID = 18316030 ] [ RRC reference ]

Hukema RK, Rademakers S, Jansen G.
Gustatory plasticity in C. elegans involves integration of negative cues and NaCl taste mediated by serotonin, dopamine, and glutamate.
Learn. Mem. 2008 15(11) 829-36 
[ PubMed ID = 18984564 ] [ RRC reference ]

Wragg RT, Hapiak V, Miller SB, Harris GP, Gray J, Komuniecki PR, Komuniecki RW.
Tyramine and octopamine independently inhibit serotonin-stimulated aversive behaviors in Caenorhabditis elegans through two novel amine receptors.
J. Neurosci. 2007 27(49) 13402-12 
[ PubMed ID = 18057198 ] [ RRC reference ]