Mutants (Isolated)

tm9006

Allele Nametm9006
Sequence NameC34E11.1
CGC Namersd-3
Worm BaseAllele Name tm9006
CGC Name rsd-3
Sequence C34E11.1
Phenotypehomozygous viable
Mutation site1397/1398-TTTTTTT-9206/9207 (7809 bp deletion + 7 bp insertion)
ChromosomeX
Putative gene structurejoin(7304..7398, 8240..8356, 8401..8491, 9070..9208, 9257..9567, 9853..10033, 10312..10412, 10457..10546, 10612..10824, 11935..12048)
Map position6.73
Balancer
Map position of balancer
Sequence of primersExtRev:CGAATGAGAGCATGCGTCTA,IntRev:GATGGCGAGCGATTGACATT,ExtFwd:TTTCTCCCATGTCCCTCAAC,IntFwd:GTACTACACATAGGTACTGG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Imae R, Dejima K, Kage-Nakadai E, Arai H, Mitani S.
Endomembrane-associated RSD-3 is important for RNAi induced by extracellular silencing RNA in both somatic and germ cells of Caenorhabditis elegans.
Sci Rep 2016 6 28198 
[ PubMed ID = 27306325 ] [ RRC reference ]