Home > Mutants (Isolated) > tm8953

Mutants (Isolated)

Allele Name		tm8953
Allele Type		Normal
Sequence Name		Y59H11AL.1
Gene Name		npr-22
Worm Base	Allele Name	tm8953
	Gene Name	npr-22
	Sequence	Y59H11AL.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		10543/10544-T-10630/10631 (87 bp deletion + 1 bp insertion)
Chromosome		IV
Putative gene structure		join(10031..10214, 10595..10727, 10876..11417, 11848..11975, 12034..12198, 13273..13406)
Map position		3.89
Balancer
Map position of balancer
Sequence of primers		ExtFwd:GGAGGGGGTATTGGAAGCAG,ExtRev:GCCGAAGAGCCAACGTTGAT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Otarigho B, Butts AF, Aballay A. Neuronal NPR-15 modulates molecular and behavioral immune responses via the amphid sensory neuron-intestinal axis in C. elegans. Elife 2024 12   [ PubMed ID = 38446031 ] [ RRC reference ] Motomura H, Ioroi M, Murakami K, Kuhara A, Ohta A. Head-tail-head neural wiring underlies gut fat storage in Caenorhabditis elegans temperature acclimation. Proc Natl Acad Sci U S A 2022 119(32) e2203121119  [ PubMed ID = 35914124 ] [ RRC reference ]