Mutants (Isolated)

tm892

Allele Nametm892
Sequence NameF20D12.1
CGC Namecsr-1
Worm BaseAllele Name tm892
CGC Name csr-1
Sequence F20D12.1
Phenotypelethal or sterile. Dr. C. Mello, Cell 127, 747-457 (2006). Dr. E. Miska; Mol Cell 31, 79-90 (2008).
Mutation site26731/26372-27131/27132 (400 bp deletion)
ChromosomeIV
Putative gene structurejoin(25568..26042, 26587..26746, 26788..26941, 26985..27196, 27241..27392, 27440..27825, 27871..28592, 28637..28736, 28781..29137, 29188..29376, 29420..29508, 29555..29651)
Map position3.52
Balancerunc-24 (e138) IV
Map position of balancer3.52
Sequence of primersExtFwd:GGCCTTTCTCTGCGTTTAGT,IntFwd:GCCCTGAACATCTTCGGGCT,ExtRev:CGCAGCGTTTCGGTCAGGAT,IntRev:TCAGGATGAGCAACGTCCAT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Quarato P, Singh M, Cornes E, Li B, Bourdon L, Mueller F, Didier C, Cecere G.
Germline inherited small RNAs facilitate the clearance of untranslated maternal mRNAs in C. elegans embryos.
Nat Commun 2021 12(1) 1441 
[ PubMed ID = 33664268 ] [ RRC reference ]

Yang B, Xu X, Russell L, Sullenberger MT, Yanowitz JL, Maine EM.
A DNA repair protein and histone methyltransferase interact to promote genome stability in the Caenorhabditis elegans germ line.
PLoS Genet 2019 15(2) e1007992 
[ PubMed ID = 30794539 ] [ RRC reference ]

Ow MC, Borziak K, Nichitean AM, Dorus S, Hall SE.
Early experiences mediate distinct adult gene expression and reproductive programs in Caenorhabditis elegans.
PLoS Genet 2018 14(2) e1007219 
[ PubMed ID = 29447162 ] [ RRC reference ]

Gerson-Gurwitz A, Wang S, Sathe S, Green R, Yeo GW, Oegema K, Desai A.
A Small RNA-Catalytic Argonaute Pathway Tunes Germline Transcript Levels to Ensure Embryonic Divisions.
Cell 2016 165(2) 396-409 
[ PubMed ID = 27020753 ] [ RRC reference ]

Bharadwaj PS, Hall SE.
Endogenous RNAi Pathways Are Required in Neurons for Dauer Formation in Caenorhabditis elegans.
Genetics 2017 205(4) 1503-1516 
[ PubMed ID = 28122825 ] [ RRC reference ]

Ishidate T, Ozturk AR, Durning DJ, Sharma R, Shen EZ, Chen H, Seth M, Shirayama M, Mello CC.
ZNFX-1 Functions within Perinuclear Nuage to Balance Epigenetic Signals.
Mol Cell 2018 70(4) 639-649.e6 
[ PubMed ID = 29775580 ] [ RRC reference ]

Fassnacht C, Tocchini C, Kumari P, Gaidatzis D, Stadler MB, Ciosk R.
The CSR-1 endogenous RNAi pathway ensures accurate transcriptional reprogramming during the oocyte-to-embryo transition in Caenorhabditis elegans.
PLoS Genet 2018 14(3) e1007252 
[ PubMed ID = 29579041 ] [ RRC reference ]

Tyc KM, Nabih A, Wu MZ, Wedeles CJ, Sobotka JA, Claycomb JM.
The Conserved Intron Binding Protein EMB-4 Plays Differential Roles in Germline Small RNA Pathways of C. elegans.
Dev Cell 2017 42(3) 256-270.e6 
[ PubMed ID = 28787592 ] [ RRC reference ]

Tu S, Wu MZ, Wang J, Cutter AD, Weng Z, Claycomb JM.
Comparative functional characterization of the CSR-1 22G-RNA pathway in Caenorhabditis nematodes.
Nucleic Acids Res 2015 43(1) 208-24 
[ PubMed ID = 25510497 ] [ RRC reference ]

Cecere G, Hoersch S, O'Keeffe S, Sachidanandam R, Grishok A.
Global effects of the CSR-1 RNA interference pathway on the transcriptional landscape.
Nat Struct Mol Biol 2014 21(4) 358-65 
[ PubMed ID = 24681887 ] [ RRC reference ]

Ouyang JPT, Folkmann A, Bernard L, Lee CY, Seroussi U, Charlesworth AG, Claycomb JM, Seydoux G.
P Granules Protect RNA Interference Genes from Silencing by piRNAs.
Dev Cell 2019 50(6) 716-728.e6 
[ PubMed ID = 31402283 ] [ RRC reference ]

Mutlu B, Chen HM, Gutnik S, Hall DH, Keppler-Ross S, Mango SE.
Distinct functions and temporal regulation of methylated histone H3 during early embryogenesis.
Development 2019 146(19)  
[ PubMed ID = 31540912 ] [ RRC reference ]

Gushchanskaia ES, Esse R, Ma Q, Lau NC, Grishok A.
Interplay between small RNA pathways shapes chromatin landscapes in C. elegans.
Nucleic Acids Res 2019 47(11) 5603-5616 
[ PubMed ID = 31216042 ] [ RRC reference ]

Davis GM, Tu S, Anderson JW, Colson RN, Gunzburg MJ, Francisco MA, Ray D, Shrubsole SP, Sobotka JA, Seroussi U, Lao RX, Maity T, Wu MZ, McJunkin K, Morris QD, Hughes TR, Wilce JA, Claycomb JM, Weng Z, Boag PR.
The TRIM-NHL protein NHL-2 is a co-factor in the nuclear and somatic RNAi pathways in C. elegans.
Elife 2018 7  
[ PubMed ID = 30575518 ] [ RRC reference ]

Maniar JM, Fire AZ.
EGO-1, a C. elegans RdRP, modulates gene expression via production of mRNA-templated short antisense RNAs.
Curr Biol 2011 21(6) 449-59 
[ PubMed ID = 21396820 ] [ RRC reference ]

Avgousti DC, Palani S, Sherman Y, Grishok A.
CSR-1 RNAi pathway positively regulates histone expression in C. elegans.
EMBO J 2012 31(19) 3821-32 
[ PubMed ID = 22863779 ] [ RRC reference ]

Wedeles CJ, Wu MZ, Claycomb JM.
Protection of germline gene expression by the C. elegans Argonaute CSR-1.
Dev Cell 2013 27(6) 664-71 
[ PubMed ID = 24360783 ] [ RRC reference ]

Seth M, Shirayama M, Gu W, Ishidate T, Conte D Jr, Mello CC.
The C. elegans CSR-1 argonaute pathway counteracts epigenetic silencing to promote germline gene expression.
Dev Cell 2013 27(6) 656-63 
[ PubMed ID = 24360782 ] [ RRC reference ]

Barberán-Soler S, Fontrodona L, Ribó A, Lamm AT, Iannone C, Cerón J, Lehner B, Valcárcel J.
Co-option of the piRNA pathway for germline-specific alternative splicing of C. elegans TOR.
Cell Rep 2014 8(6) 1609-1616 
[ PubMed ID = 25220461 ] [ RRC reference ]

Kennedy LM, Grishok A.
Neuronal migration is regulated by endogenous RNAi and chromatin-binding factor ZFP-1/AF10 in Caenorhabditis elegans.
Genetics 2014 197(1) 207-20 
[ PubMed ID = 24558261 ] [ RRC reference ]