Mutants (Isolated)

tm892

Allele Nametm892
Sequence NameF20D12.1
CGC Namecsr-1
Worm BaseAllele Name tm892
CGC Name csr-1
Sequence F20D12.1
Phenotypelethal or sterile. Dr. C. Mello, Cell 127, 747-457 (2006). Dr. E. Miska; Mol Cell 31, 79-90 (2008).
Mutation site26731/26372-27131/27132 (400 bp deletion)
ChromosomeIV
Putative gene structurejoin(25568..26042, 26587..26746, 26788..26941, 26985..27196, 27241..27392, 27440..27825, 27871..28592, 28637..28736, 28781..29137, 29188..29376, 29420..29508, 29555..29651)
Map position3.52
Balancerunc-24 (e138) IV
Map position of balancer3.52
Sequence of primersExtFwd:GGCCTTTCTCTGCGTTTAGT,IntFwd:GCCCTGAACATCTTCGGGCT,ExtRev:CGCAGCGTTTCGGTCAGGAT,IntRev:TCAGGATGAGCAACGTCCAT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Yang B, Xu X, Russell L, Sullenberger MT, Yanowitz JL, Maine EM.
A DNA repair protein and histone methyltransferase interact to promote genome stability in the Caenorhabditis elegans germ line.
PLoS Genet. 2019 15(2) e1007992 
[ PubMed ID = 30794539 ] [ RRC reference ]

Ow MC, Borziak K, Nichitean AM, Dorus S, Hall SE.
Early experiences mediate distinct adult gene expression and reproductive programs in Caenorhabditis elegans.
PLoS Genet. 2018 14(2) e1007219 
[ PubMed ID = 29447162 ] [ RRC reference ]

Gerson-Gurwitz A, Wang S, Sathe S, Green R, Yeo GW, Oegema K, Desai A.
A Small RNA-Catalytic Argonaute Pathway Tunes Germline Transcript Levels to Ensure Embryonic Divisions.
Cell 2016 165(2) 396-409 
[ PubMed ID = 27020753 ] [ RRC reference ]

Ishidate T, Ozturk AR, Durning DJ, Sharma R, Shen EZ, Chen H, Seth M, Shirayama M, Mello CC.
ZNFX-1 Functions within Perinuclear Nuage to Balance Epigenetic Signals.
Mol. Cell 2018 70(4) 639-649.e6 
[ PubMed ID = 29775580 ] [ RRC reference ]

Bharadwaj PS, Hall SE.
Endogenous RNAi Pathways Are Required in Neurons for Dauer Formation in Caenorhabditis elegans.
Genetics 2017 205(4) 1503-1516 
[ PubMed ID = 28122825 ] [ RRC reference ]

Fassnacht C, Tocchini C, Kumari P, Gaidatzis D, Stadler MB, Ciosk R.
The CSR-1 endogenous RNAi pathway ensures accurate transcriptional reprogramming during the oocyte-to-embryo transition in Caenorhabditis elegans.
PLoS Genet. 2018 14(3) e1007252 
[ PubMed ID = 29579041 ] [ RRC reference ]

Mutlu B, Chen HM, Gutnik S, Hall DH, Keppler-Ross S, Mango SE.
Distinct functions and temporal regulation of methylated histone H3 during early embryogenesis.
Development 2019 146(19)  
[ PubMed ID = 31540912 ] [ RRC reference ]

Gushchanskaia ES, Esse R, Ma Q, Lau NC, Grishok A.
Interplay between small RNA pathways shapes chromatin landscapes in C. elegans.
Nucleic Acids Res. 2019 47(11) 5603-5616 
[ PubMed ID = 31216042 ] [ RRC reference ]

Tyc KM, Nabih A, Wu MZ, Wedeles CJ, Sobotka JA, Claycomb JM.
The Conserved Intron Binding Protein EMB-4 Plays Differential Roles in Germline Small RNA Pathways of C. elegans.
Dev. Cell 2017 42(3) 256-270.e6 
[ PubMed ID = 28787592 ] [ RRC reference ]

Tu S, Wu MZ, Wang J, Cutter AD, Weng Z, Claycomb JM.
Comparative functional characterization of the CSR-1 22G-RNA pathway in Caenorhabditis nematodes.
Nucleic Acids Res. 2015 43(1) 208-24 
[ PubMed ID = 25510497 ] [ RRC reference ]

Cecere G, Hoersch S, O'Keeffe S, Sachidanandam R, Grishok A.
Global effects of the CSR-1 RNA interference pathway on the transcriptional landscape.
Nat. Struct. Mol. Biol. 2014 21(4) 358-65 
[ PubMed ID = 24681887 ] [ RRC reference ]

Maniar JM, Fire AZ.
EGO-1, a C. elegans RdRP, modulates gene expression via production of mRNA-templated short antisense RNAs.
Curr. Biol. 2011 21(6) 449-59 
[ PubMed ID = 21396820 ] [ RRC reference ]

Avgousti DC, Palani S, Sherman Y, Grishok A.
CSR-1 RNAi pathway positively regulates histone expression in C. elegans.
EMBO J. 2012 31(19) 3821-32 
[ PubMed ID = 22863779 ] [ RRC reference ]

Wedeles CJ, Wu MZ, Claycomb JM.
Protection of germline gene expression by the C. elegans Argonaute CSR-1.
Dev. Cell 2013 27(6) 664-71 
[ PubMed ID = 24360783 ] [ RRC reference ]

Seth M, Shirayama M, Gu W, Ishidate T, Conte D Jr, Mello CC.
The C. elegans CSR-1 argonaute pathway counteracts epigenetic silencing to promote germline gene expression.
Dev. Cell 2013 27(6) 656-63 
[ PubMed ID = 24360782 ] [ RRC reference ]

Barberán-Soler S, Fontrodona L, Ribó A, Lamm AT, Iannone C, Cerón J, Lehner B, Valcárcel J.
Co-option of the piRNA pathway for germline-specific alternative splicing of C. elegans TOR.
Cell Rep 2014 8(6) 1609-1616 
[ PubMed ID = 25220461 ] [ RRC reference ]

Kennedy LM, Grishok A.
Neuronal migration is regulated by endogenous RNAi and chromatin-binding factor ZFP-1/AF10 in Caenorhabditis elegans.
Genetics 2014 197(1) 207-20 
[ PubMed ID = 24558261 ] [ RRC reference ]

Goh WS, Seah JW, Harrison EJ, Chen C, Hammell CM, Hannon GJ.
A genome-wide RNAi screen identifies factors required for distinct stages of C. elegans piRNA biogenesis.
Genes Dev. 2014 28(7) 797-807 
[ PubMed ID = 24696458 ] [ RRC reference ]

Conine CC, Moresco JJ, Gu W, Shirayama M, Conte D Jr, Yates JR 3rd, Mello CC.
Argonautes promote male fertility and provide a paternal memory of germline gene expression in C. elegans.
Cell 2013 155(7) 1532-44 
[ PubMed ID = 24360276 ] [ RRC reference ]

Hall SE, Chirn GW, Lau NC, Sengupta P.
RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans.
RNA 2013 19(3) 306-19 
[ PubMed ID = 23329696 ] [ RRC reference ]