Mutants (Isolated)

tm892

Allele Nametm892
Sequence NameF20D12.1
CGC Namecsr-1
Worm BaseAllele Name tm892
CGC Name csr-1
Sequence F20D12.1
Phenotypelethal or sterile. Dr. C. Mello, Cell 127, 747-457 (2006). Dr. E. Miska; Mol Cell 31, 79-90 (2008).
Mutation site26731/26372-27131/27132 (400 bp deletion)
ChromosomeIV
Putative gene structurejoin(25568..26042, 26587..26746, 26788..26941, 26985..27196, 27241..27392, 27440..27825, 27871..28592, 28637..28736, 28781..29137, 29188..29376, 29420..29508, 29555..29651)
Map position3.52
Balancerunc-24 (e138) IV
Map position of balancer3.52
Sequence of primersExtFwd:GGCCTTTCTCTGCGTTTAGT,IntFwd:GCCCTGAACATCTTCGGGCT,ExtRev:CGCAGCGTTTCGGTCAGGAT,IntRev:TCAGGATGAGCAACGTCCAT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Ow MC, Borziak K, Nichitean AM, Dorus S, Hall SE.
Early experiences mediate distinct adult gene expression and reproductive programs in Caenorhabditis elegans.
PLoS Genet. 2018 14(2) e1007219 
[ PubMed ID = 29447162 ] [ RRC reference ]

Bharadwaj PS, Hall SE.
Endogenous RNAi Pathways Are Required in Neurons for Dauer Formation in Caenorhabditis elegans.
Genetics 2017 205(4) 1503-1516 
[ PubMed ID = 28122825 ] [ RRC reference ]

Cecere G, Hoersch S, O'Keeffe S, Sachidanandam R, Grishok A.
Global effects of the CSR-1 RNA interference pathway on the transcriptional landscape.
Nat. Struct. Mol. Biol. 2014 21(4) 358-65 
[ PubMed ID = 24681887 ] [ RRC reference ]

Tu S, Wu MZ, Wang J, Cutter AD, Weng Z, Claycomb JM.
Comparative functional characterization of the CSR-1 22G-RNA pathway in Caenorhabditis nematodes.
Nucleic Acids Res. 2015 43(1) 208-24 
[ PubMed ID = 25510497 ] [ RRC reference ]

Updike DL, Strome S.
A genomewide RNAi screen for genes that affect the stability, distribution and function of P granules in Caenorhabditis elegans.
Genetics 2009 183(4) 1397-419 
[ PubMed ID = 19805813 ] [ RRC reference ]

Fassnacht C, Tocchini C, Kumari P, Gaidatzis D, Stadler MB, Ciosk R.
The CSR-1 endogenous RNAi pathway ensures accurate transcriptional reprogramming during the oocyte-to-embryo transition in Caenorhabditis elegans.
PLoS Genet. 2018 14(3) e1007252 
[ PubMed ID = 29579041 ] [ RRC reference ]

Tyc KM, Nabih A, Wu MZ, Wedeles CJ, Sobotka JA, Claycomb JM.
The Conserved Intron Binding Protein EMB-4 Plays Differential Roles in Germline Small RNA Pathways of C. elegans.
Dev. Cell 2017 42(3) 256-270.e6 
[ PubMed ID = 28787592 ] [ RRC reference ]

Barberán-Soler S, Fontrodona L, Ribó A, Lamm AT, Iannone C, Cerón J, Lehner B, Valcárcel J.
Co-option of the piRNA pathway for germline-specific alternative splicing of C. elegans TOR.
Cell Rep 2014 8(6) 1609-1616 
[ PubMed ID = 25220461 ] [ RRC reference ]

Seth M, Shirayama M, Gu W, Ishidate T, Conte D Jr, Mello CC.
The C. elegans CSR-1 argonaute pathway counteracts epigenetic silencing to promote germline gene expression.
Dev. Cell 2013 27(6) 656-63 
[ PubMed ID = 24360782 ] [ RRC reference ]

Wedeles CJ, Wu MZ, Claycomb JM.
Protection of germline gene expression by the C. elegans Argonaute CSR-1.
Dev. Cell 2013 27(6) 664-71 
[ PubMed ID = 24360783 ] [ RRC reference ]

Avgousti DC, Palani S, Sherman Y, Grishok A.
CSR-1 RNAi pathway positively regulates histone expression in C. elegans.
EMBO J. 2012 31(19) 3821-32 
[ PubMed ID = 22863779 ] [ RRC reference ]

Maniar JM, Fire AZ.
EGO-1, a C. elegans RdRP, modulates gene expression via production of mRNA-templated short antisense RNAs.
Curr. Biol. 2011 21(6) 449-59 
[ PubMed ID = 21396820 ] [ RRC reference ]

Claycomb JM, Batista PJ, Pang KM, Gu W, Vasale JJ, van Wolfswinkel JC, Chaves DA, Shirayama M, Mitani S, Ketting RF, Conte D Jr, Mello CC.
The Argonaute CSR-1 and its 22G-RNA cofactors are required for holocentric chromosome segregation.
Cell 2009 139(1) 123-34 
[ PubMed ID = 19804758 ] [ RRC reference ]

Ishidate T, Ozturk AR, Durning DJ, Sharma R, Shen EZ, Chen H, Seth M, Shirayama M, Mello CC.
ZNFX-1 Functions within Perinuclear Nuage to Balance Epigenetic Signals.
Mol. Cell 2018 70(4) 639-649.e6 
[ PubMed ID = 29775580 ] [ RRC reference ]

Conine CC, Moresco JJ, Gu W, Shirayama M, Conte D Jr, Yates JR 3rd, Mello CC.
Argonautes promote male fertility and provide a paternal memory of germline gene expression in C. elegans.
Cell 2013 155(7) 1532-44 
[ PubMed ID = 24360276 ] [ RRC reference ]

Kennedy LM, Grishok A.
Neuronal migration is regulated by endogenous RNAi and chromatin-binding factor ZFP-1/AF10 in Caenorhabditis elegans.
Genetics 2014 197(1) 207-20 
[ PubMed ID = 24558261 ] [ RRC reference ]

Goh WS, Seah JW, Harrison EJ, Chen C, Hammell CM, Hannon GJ.
A genome-wide RNAi screen identifies factors required for distinct stages of C. elegans piRNA biogenesis.
Genes Dev. 2014 28(7) 797-807 
[ PubMed ID = 24696458 ] [ RRC reference ]

She X, Xu X, Fedotov A, Kelly WG, Maine EM.
Regulation of heterochromatin assembly on unpaired chromosomes during Caenorhabditis elegans meiosis by components of a small RNA-mediated pathway.
PLoS Genet. 2009 5(8) e1000624 
[ PubMed ID = 19714217 ] [ RRC reference ]

Hall SE, Chirn GW, Lau NC, Sengupta P.
RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans.
RNA 2013 19(3) 306-19 
[ PubMed ID = 23329696 ] [ RRC reference ]