Mutants (Isolated)

tm886

Allele Nametm886
Sequence NameE02H1.7
CGC Namenhr-19
Worm BaseAllele Name tm886
CGC Name nhr-19
Sequence E02H1.7
Phenotypehomozygous viable
Mutation site12109/12110-ACNAGAAACTTTC-12590/12591 (481 bp deletion + 13 bp insertion)
ChromosomeII
Putative gene structurecomplement(join(9934..9999, 10231..10629, 10715..11050, 11122..11200, 11254..11410, 11561..11688, 11742..11835, 12266..12347))
Map position1.62
Balancer
Map position of balancer
Sequence of primersExtFwd:TGCGACGAGAAGCTTCGGTG,IntFwd:CTTGACGCCATCGACGATCA,ExtRev:CCTATCGTCTTCCCGTACGT,IntRev:TCCCGTACGTCCTTCGTCCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sonoda S, Ohta A, Maruo A, Ujisawa T, Kuhara A.
Sperm Affects Head Sensory Neuron in Temperature Tolerance of Caenorhabditis elegans.
Cell Rep 2016 16(1) 56-65 
[ PubMed ID = 27320929 ] [ RRC reference ]