Mutants (Isolated)

tm874

Allele Nametm874
Sequence NameC03D6.5
CGC Nameasfl-1
Worm BaseAllele Name tm874
CGC Name asfl-1
Sequence C03D6.5
Phenotypehomozygous viable. homozygous WT and fertile. Dr. M. Colaiacovo: Genes & Dev, 22, 2869 (2008). Dr. F.P. Finger: Dev. Biol.329, 64 (2009)
Mutation site1189/1190-1812/1813 (623 bp deletion)
ChromosomeI
Putative gene structurejoin(1448..1559, 1603..1934, 1969..2121, 2523..2693, 2743..2893, 2971..3071)
Map position3.84
Balancer
Map position of balancer
Sequence of primersExtFwd:CATCGGGCACCCAGATCACT,IntFwd:CTTTCTTGCACTCGTCCGTT,IntRev:GCGAAGATCTTCGGTTTCGA,ExtRev:TTGGGAATGTGGTGACGCGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Grigsby IF, Rutledge EM, Morton CA, Finger FP.
Functional redundancy of two C. elegans homologs of the histone chaperone Asf1 in germline DNA replication.
Dev Biol 2009 329(1) 64-79 
[ PubMed ID = 19233156 ] [ RRC reference ]