Mutants (Isolated)

tm863

Allele Nametm863
Sequence NameT09A5.3
CGC Nameacr-7
Worm BaseAllele Name tm863
CGC Name acr-7
Sequence T09A5.3
Phenotypehomozygous viable. Dr. J-L. Bessereau: sensitive to nicotinic agonist DMPP after backcross.
Mutation site16544/16545-GCTTCAG-17169/17170 (625 bp deletion + 7 bp insertion)
ChromosomeII
Putative gene structurecomplement(join(13764..13883, 14304..14419, 16232..16358, 16404..16603, 16657..16790, 16840..16957, 17048..17171, 17220..17310, 17357..17481, 17528..17675, 17718..17821))
Map position0.58
Balancer
Map position of balancer
Sequence of primersIntFwd:CCCACTACGTACAGAGGTAT,ExtFwd:GATTGCATTTCAAGCCCACT,IntRev:GAGGAGTGAATGAGCATTGT,ExtRev:TGAATTGCCCTCTCGTCTAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ruaud AF, Bessereau JL.
Activation of nicotinic receptors uncouples a developmental timer from the molting timer in C. elegans.
Development 2006 133(11) 2211-22 
[ PubMed ID = 16672334 ] [ RRC reference ]

White CV, Herman MA.
Transcriptomic, Functional, and Network Analyses Reveal Novel Genes Involved in the Interaction Between Caenorhabditis elegans and Stenotrophomonas maltophilia.
Front Cell Infect Microbiol 2018 8 266 
[ PubMed ID = 30177956 ] [ RRC reference ]

Saur T, DeMarco SE, Ortiz A, Sliwoski GR, Hao L, Wang X, Cohen BM, Buttner EA.
A genome-wide RNAi screen in Caenorhabditis elegans identifies the nicotinic acetylcholine receptor subunit ACR-7 as an antipsychotic drug target.
PLoS Genet. 2013 9(2) e1003313 
[ PubMed ID = 23468647 ] [ RRC reference ]

Yu H, Aleman-Meza B, Gharib S, Labocha MK, Cronin CJ, Sternberg PW, Zhong W.
Systematic profiling of Caenorhabditis elegans locomotive behaviors reveals additional components in G-protein Gαq signaling.
Proc. Natl. Acad. Sci. U.S.A. 2013 110(29) 11940-5 
[ PubMed ID = 23818641 ] [ RRC reference ]

Yemini E, Jucikas T, Grundy LJ, Brown AE, Schafer WR.
A database of Caenorhabditis elegans behavioral phenotypes.
Nat. Methods 2013 10(9) 877-9 
[ PubMed ID = 23852451 ] [ RRC reference ]