Mutants (Isolated)

tm861

Allele Nametm861
Sequence NameC27B7.8
CGC Namerap-1
Worm BaseAllele Name tm861
CGC Name rap-1
Sequence C27B7.8
Phenotypelethal or sterile. Dr. O. Blacque: could not examine Dyf phenotype.
Mutation site28495/28496-28995/28996 (500 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(27359..27460, 28236..28376, 28425..28565, 28615..28671, 29074..29142, 29192..29248))
Map position4
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersIntRev:CCAAGCATCAACAACACCAT,IntFwd:GGTCGTAGAACACCTGAAAT,ExtFwd:TATTTGACGAACGAGGTCGT,ExtRev:GGTCGTCGATTGCAGGGAAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Frische EW, Pellis-van Berkel W, van Haaften G, Cuppen E, Plasterk RH, Tijsterman M, Bos JL, Zwartkruis FJ.
RAP-1 and the RAL-1/exocyst pathway coordinate hypodermal cell organization in Caenorhabditis elegans.
EMBO J. 2007 26(24) 5083-92 
[ PubMed ID = 17989692 ] [ RRC reference ]

Reiner DJ, Lundquist EA.
Small GTPases.
WormBook 2018 2018 1-65 
[ PubMed ID = 27218782 ] [ RRC reference ]

Fay DS, Polley SR, Kuang J, Kuzmanov A, Hazel JW, Mani K, Veo BL, Yochem J.
A regulatory module controlling pharyngeal development and function in Caenorhabditis elegans.
Genetics 2012 191(3) 827-43 
[ PubMed ID = 22542967 ] [ RRC reference ]