Mutants (Isolated)

tm857

Allele Nametm857
Sequence NameC33G8.7
CGC Namenhr-161
Worm BaseAllele Name tm857
CGC Name nhr-161
Sequence C33G8.7
PhenotypeHomozygous viable
Mutation site1594/1595-C-1925/1926 (331 bp deletion + 1 bp insertion)
ChromosomeV
Putative gene structurecomplement(join(827..934, 1004..1663, 1719..1774, 1980..2113, 2158..2235, 2278..2390))
Map position0.49
Balancer
Map position of balancer
Sequence of primersExtFwd:GTGTCATGACCATCCGCCGA,ExtRev:CAACCAACCCCAGAAGGGAA,IntFwd:CGAAAGTCGTCGTCAACTGT,IntRev:GGCGAACCAAACCACAAATC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Shi A, Sun L, Banerjee R, Tobin M, Zhang Y, Grant BD.
Regulation of endosomal clathrin and retromer-mediated endosome to Golgi retrograde transport by the J-domain protein RME-8.
EMBO J. 2009 28(21) 3290-302 
[ PubMed ID = 19763082 ] [ RRC reference ]