Mutants (Isolated)

tm850

Allele Nametm850
Sequence NameF59A6.1
CGC Namensy-1
Worm BaseAllele Name tm850
CGC Name nsy-1
Sequence F59A6.1
PhenotypeHomozygous viable
Mutation site28901/28902-30098/30099 (1197 bp deletion)
ChromosomeII
Putative gene structurejoin(27872..27925, 28652..28894, 29122..29409, 29457..29851, 29901..30019, 30459..31236, 31283..32197, 32513..33293, 33356..33946)
Map position-2.59
Balancer
Map position of balancer
Sequence of primersExtRev:ATCAGTGTCTGCCTCAGTTG,ExtFwd:CTTTGCCACTACCGCCACGT,IntFwd:CATACCACGCAAGTCGAATG,IntRev:GCCTCCATGAAGAATTCACT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Hayakawa T, Kato K, Hayakawa R, Hisamoto N, Matsumoto K, Takeda K, Ichijo H.
Regulation of anoxic death in Caenorhabditis elegans by mammalian apoptosis signal-regulating kinase (ASK) family proteins.
Genetics 2011 187(3) 785-92 
[ PubMed ID = 21212236 ] [ RRC reference ]