Mutants (Isolated)

tm843

Allele Nametm843
Sequence NameC30H6.6
CGC Namehaf-1
Worm BaseAllele Name tm843
CGC Name haf-1
Sequence C30H6.6
PhenotypeHomozygous viable. Dr. L. Timmons: negative for RNAi defects using various feeding strains to deliver dsRNA.
Mutation site25783/25784-26622/26623 (839 bp deletion)
ChromosomeIV
Putative gene structurejoin(25559..25772, 25825..26162, 26211..26357, 26405..26486, 26531..27111, 27158..27357, 27401..27599)
Map position16.59
Balancer
Map position of balancer
Sequence of primersExtFwd:GATTGTTAGCAATCGGTGCA,IntRev:GCCACAGGAGTATTTACTCT,IntFwd:CATTGGCTACAGCTGCGAAA,ExtRev:TAATGAAAATCCGCGAGCCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mao XR, Kaufman DM, Crowder CM.
Nicotinamide mononucleotide adenylyltransferase promotes hypoxic survival by activating the mitochondrial unfolded protein response.
Cell Death Dis 2016 7 e2113 
[ PubMed ID = 26913604 ] [ RRC reference ]

Kaufman DM, Crowder CM.
Mitochondrial Proteostatic Collapse Leads to Hypoxic Injury.
Curr. Biol. 2015 25(16) 2171-6 
[ PubMed ID = 26234215 ] [ RRC reference ]

Haynes CM, Yang Y, Blais SP, Neubert TA, Ron D.
The matrix peptide exporter HAF-1 signals a mitochondrial UPR by activating the transcription factor ZC376.7 in C. elegans.
Mol. Cell 2010 37(4) 529-40 
[ PubMed ID = 20188671 ] [ RRC reference ]

Sundaram P, Han W, Cohen N, Echalier B, Albin J, Timmons L.
Caenorhabditis elegans ABCRNAi transporters interact genetically with rde-2 and mut-7.
Genetics 2008 178(2) 801-14 
[ PubMed ID = 18245353 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]