Mutants (Isolated)

tm840

Allele Nametm840
Sequence NameC18G1.2
CGC Nameelt-7
Worm BaseAllele Name tm840
CGC Name elt-7
Sequence C18G1.2
PhenotypeHomozygous viable. Dr. P. Sengupta: dyf+ in all sensory neurons.
Mutation site28742/28743-29358/29359 (616 bp deletion)
ChromosomeV
Putative gene structurejoin(27796..27917, 28796..29081, 29135..29220, 29866..29968)
Map position-4.22
Balancer
Map position of balancer
Sequence of primersExtRev:GGGATACGTAATATGCTGGA,IntRev:TGGCGATACAGTCCAAACTT,IntFwd:TGCATCTCTGACTTACCACT,ExtFwd:GCACACAAGGCATAGGTACA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Wiesenfahrt T, Duanmu J, Snider F, Moerman D, Au V, Li-Leger E, Flibotte S, Parker DM, Marshall CJ, Nishimura EO, Mains PE, McGhee JD.
A Strategy To Isolate Modifiers of Caenorhabditis elegans Lethal Mutations: Investigating the Endoderm Specifying Ability of the Intestinal Differentiation GATA Factor ELT-2.
G3 (Bethesda) 2018 8(5) 1425-1437 
[ PubMed ID = 29593072 ] [ RRC reference ]

Dineen A, Osborne Nishimura E, Goszczynski B, Rothman JH, McGhee JD.
Quantitating transcription factor redundancy: The relative roles of the ELT-2 and ELT-7 GATA factors in the C. elegans endoderm.
Dev Biol 2018 435(2) 150-161 
[ PubMed ID = 29360433 ] [ RRC reference ]

Wiesenfahrt T, Berg JY, Osborne Nishimura E, Robinson AG, Goszczynski B, Lieb JD, McGhee JD.
The function and regulation of the GATA factor ELT-2 in the C. elegans endoderm.
Development 2016 143(3) 483-91 
[ PubMed ID = 26700680 ] [ RRC reference ]

Sommermann EM, Strohmaier KR, Maduro MF, Rothman JH.
Endoderm development in Caenorhabditis elegans: the synergistic action of ELT-2 and -7 mediates the specification→differentiation transition.
Dev Biol 2010 347(1) 154-66 
[ PubMed ID = 20807527 ] [ RRC reference ]

Nair G, Walton T, Murray JI, Raj A.
Gene transcription is coordinated with, but not dependent on, cell divisions during C. elegans embryonic fate specification.
Development 2013 140(16) 3385-94 
[ PubMed ID = 23863485 ] [ RRC reference ]

McGhee JD, Sleumer MC, Bilenky M, Wong K, McKay SJ, Goszczynski B, Tian H, Krich ND, Khattra J, Holt RA, Baillie DL, Kohara Y, Marra MA, Jones SJ, Moerman DG, Robertson AG.
The ELT-2 GATA-factor and the global regulation of transcription in the C. elegans intestine.
Dev Biol 2007 302(2) 627-45 
[ PubMed ID = 17113066 ] [ RRC reference ]