Mutants (Isolated)

tm830

Allele Nametm830
Sequence NameC47A10.1
CGC Namepgp-9
Worm BaseAllele Name tm830
CGC Name pgp-9
Sequence C47A10.1
PhenotypeHomozygous viable. Dr. L. Timmons: negative for RNAi defects using various feeding strains to deliver dsRNA. Dr. I. Mori: normal thermotaxis when cultured at 17&23 C.
Mutation site5091/5092-5701/5702 (610 bp deletion)
ChromosomeV
Putative gene structurejoin(Z93782.1:16574..16617, 2..158, 224..391, 1190..1323, 2031..3052, 4078..4499, 4549..5078, 5500..6289, 6355..6561, 8208..8481, 8526..8662)
Map position13.19
Balancer
Map position of balancer
Sequence of primersExtFwd:TGTGCAATCGGCTCTGGAGA,IntRev:AAGTGTCTGCCCGGGCTTCA,IntFwd:GGGCGTACCACAATTGTGAT,ExtRev:CAACCACTAGGTCCCACCAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Levitte S, Salesky R, King B, Coe Smith S, Depper M, Cole M, Hermann GJ.
A Caenorhabditis elegans model of orotic aciduria reveals enlarged lysosome-related organelles in embryos lacking umps-1 function.
FEBS J. 2010 277(6) 1420-39 
[ PubMed ID = 20148972 ] [ RRC reference ]

Sundaram P, Han W, Cohen N, Echalier B, Albin J, Timmons L.
Caenorhabditis elegans ABCRNAi transporters interact genetically with rde-2 and mut-7.
Genetics 2008 178(2) 801-14 
[ PubMed ID = 18245353 ] [ RRC reference ]

Ohta A, Ujisawa T, Sonoda S, Kuhara A.
Light and pheromone-sensing neurons regulates cold habituation through insulin signalling in Caenorhabditis elegans.
Nat Commun 2014 5 4412 
[ PubMed ID = 25048458 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]