Mutants (Isolated)

tm820

Allele Nametm820
Sequence NameT22H2.5a
CGC Namescrm-1
Worm BaseAllele Name tm820
CGC Name scrm-1
Sequence T22H2.5a
PhenotypeHomozygous viable. Dr. D. Xue: Nature Cell Biol 9, 541 (2007). Dr. Z. Zhou: Mol. Biol. Cell 13, 3180 (2007).
Mutation site2144/2145-2715/2716 (571 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(772..776, 1008..1053, 1101..1159, 1206..1308, 1715..2017, 2118..2192))
Map position9.53
Balancer
Map position of balancer
Sequence of primersExtFwd:GGTCTTGCAGTTCAACGTAA,IntFwd:AACCGGTGGAGCAGGGTTAA,IntRev:CACGGAGCAACAGAGCCCTA,ExtRev:GGTGCTCCACGGAAGCATGA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Venegas V, Zhou Z.
Two alternative mechanisms that regulate the presentation of apoptotic cell engulfment signal in Caenorhabditis elegans.
Mol. Biol. Cell 2007 18(8) 3180-92 
[ PubMed ID = 17567952 ] [ RRC reference ]