Mutants (Isolated)

tm818

Allele Nametm818
Sequence NameC52E4.2
CGC Namemif-2
Worm BaseAllele Name tm818
CGC Name mif-2
Sequence C52E4.2
PhenotypeHomozygous viable
Mutation site13228/13229-14227/14228 (999 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(12880..12960, 13053..13151, 13315..13374, 13418..13480, 14190..14249))
Map position3.55
Balancer
Map position of balancer
Sequence of primersExtFwd:AATCAGCAGTTGTCGCCGGA,IntFwd:AGGCCAAGGTCTAAATGCAT,IntRev:TCCGCGGAGACTCCGTCATT,ExtRev:GTCGCCAAAGATCGTTTCAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mano I, Driscoll M.
Caenorhabditis elegans glutamate transporter deletion induces AMPA-receptor/adenylyl cyclase 9-dependent excitotoxicity.
J. Neurochem. 2009 108(6) 1373-84 
[ PubMed ID = 19054279 ] [ RRC reference ]