Mutants (Isolated)

tm814

Allele Nametm814
Sequence NameF56D1.1
CGC NameF56D1.1
Worm BaseAllele Name tm814
CGC Name F56D1.1
Sequence F56D1.1
PhenotypeLethal or sterile
Mutation site33003/33004-33532/33533 (529 bp deletion)
ChromosomeII
Putative gene structurejoin(33192..33331, 33374..33441, 33490..33620, 33665..33765, 33812..33970, 34047..34621, 34675..34808)
Map position-1.29
Balancer
Map position of balancer
Sequence of primersExtFwd:AGCCACTCATTCTCCTACCA,ExtRev:TTCGCAGCTGAAGTCTCCAT,IntFwd:GTGCGGCCCTGACTCTGATT,IntRev:CCATGTACTCGACTTCTACT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Mohammad A, Vanden Broek K, Wang C, Daryabeigi A, Jantsch V, Hansen D, Schedl T.
Initiation of Meiotic Development Is Controlled by Three Post-transcriptional Pathways in Caenorhabditis elegans.
Genetics 2018 209(4) 1197-1224 
[ PubMed ID = 29941619 ] [ RRC reference ]