Mutants (Isolated)

tm813

Allele Nametm813
Sequence NameF37H8.1
CGC Namelir-3
Worm BaseAllele Name tm813
CGC Name lir-3
Sequence F37H8.1
PhenotypeHomozygous viable
Mutation site10526/10527-11321/11322 (795 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(9946..10030, 10218..10483, 10532..10640, 10704..10856, 11302..11474, 11525..11593))
Map position3.34
Balancer
Map position of balancer
Sequence of primersIntRev:CACTATAGGCCACTTATGCT,ExtRev:GCCTGCTGGCTGAATTATCT,IntFwd:GAACCCAGTTCTGTGAGCAA,ExtFwd:AATTTGGCGATGAGAGCGAT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Sin O, Mata-Cabana A, Seinstra RI, Nollen EAA.
Filter Retardation Assay for Detecting and Quantifying Polyglutamine Aggregates Using Caenorhabditis elegans Lysates.
Bio Protoc 2018 8(19)  
[ PubMed ID = 30450365 ] [ RRC reference ]

Sin O, de Jong T, Mata-Cabana A, Kudron M, Zaini MA, Aprile FA, Seinstra RI, Stroo E, Prins RW, Martineau CN, Wang HH, Hogewerf W, Steinhof A, Wanker EE, Vendruscolo M, Calkhoven CF, Reinke V, Guryev V, Nollen EA.
Identification of an RNA Polymerase III Regulator Linked to Disease-Associated Protein Aggregation.
Mol Cell 2017 65(6) 1096-1108.e6 
[ PubMed ID = 28306505 ] [ RRC reference ]