| Allele Name | tm808 |
| Sequence Name | F32D1.1 |
| CGC Name | figl-1 |
| Worm Base | Allele Name |
tm808
|
| CGC Name |
figl-1
|
| Sequence |
F32D1.1
|
| Phenotype | Lethal or sterile. Dr. T. Ogura: sterile. Dr. M. Peter: J. Cell Sci 120, 3179 (2007). |
| Mutation site | 3063/3064-TA-4129/4130 (1066 bp deletion + 2 bp insertion) |
| Chromosome | V |
| Putative gene structure | complement(join(128..265, 1137..1767, 2779..3210, 3914..4497)) |
| Map position | -5.91 |
| Balancer | unc-62(e644) V |
| Map position of balancer | -5.18 |
| Sequence of primers | ExtRev:TAGAACCGTTGATGTGTCGT,IntRev:AAACAAGACACCCGGAAGCT,ExtFwd:GCAGTACAACAATCTCCCGT,IntFwd:TTTTCGCTCCTTCCAATCCA |
| Distributed lab | |
| Depositor | Dr. S. Mitani |
| References |
Please submit your publication
Luke-Glaser S, Pintard L, Tyers M, Peter M.
The AAA-ATPase FIGL-1 controls mitotic progression, and its levels are regulated by the CUL-3MEL-26 E3 ligase in the C. elegans germ line.
J. Cell. Sci. 2007 120(Pt 18) 3179-87
[ PubMed ID = 17878235 ]
[ RRC reference ]
|
Onitake A, Yamanaka K, Esaki M, Ogura T.
Caenorhabditis elegans fidgetin homolog FIGL-1, a nuclear-localized AAA ATPase, binds to SUMO.
J. Struct. Biol. 2012 179(2) 143-51
[ PubMed ID = 22575764 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.