Home > Mutants (Isolated) > tm808

Mutants (Isolated)

Allele Name		tm808
Sequence Name		F32D1.1
CGC Name		figl-1
Worm Base	Allele Name	tm808
	CGC Name	figl-1
	Sequence	F32D1.1
Phenotype		Lethal or sterile. Dr. T. Ogura: sterile. Dr. M. Peter: J. Cell Sci 120, 3179 (2007).
Mutation site		3063/3064-TA-4129/4130 (1066 bp deletion + 2 bp insertion)
Chromosome		V
Putative gene structure		complement(join(128..265, 1137..1767, 2779..3210, 3914..4497))
Map position		-5.91
Balancer		unc-62(e644) V
Map position of balancer		-5.18
Sequence of primers		ExtRev:TAGAACCGTTGATGTGTCGT,IntRev:AAACAAGACACCCGGAAGCT,ExtFwd:GCAGTACAACAATCTCCCGT,IntFwd:TTTTCGCTCCTTCCAATCCA
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Onitake A, Yamanaka K, Esaki M, Ogura T. Caenorhabditis elegans fidgetin homolog FIGL-1, a nuclear-localized AAA ATPase, binds to SUMO. J Struct Biol 2012 179(2) 143-51  [ PubMed ID = 22575764 ] [ RRC reference ] Luke-Glaser S, Pintard L, Tyers M, Peter M. The AAA-ATPase FIGL-1 controls mitotic progression, and its levels are regulated by the CUL-3MEL-26 E3 ligase in the C. elegans germ line. J Cell Sci 2007 120(Pt 18) 3179-87  [ PubMed ID = 17878235 ] [ RRC reference ]