Mutants (Isolated)

tm808

Allele Nametm808
Sequence NameF32D1.1
CGC Namefigl-1
Worm BaseAllele Name tm808
CGC Name figl-1
Sequence F32D1.1
PhenotypeLethal or sterile. Dr. T. Ogura: sterile. Dr. M. Peter: J. Cell Sci 120, 3179 (2007).
Mutation site3063/3064-TA-4129/4130 (1066 bp deletion + 2 bp insertion)
ChromosomeV
Putative gene structurecomplement(join(128..265, 1137..1767, 2779..3210, 3914..4497))
Map position-5.91
Balancerunc-62(e644) V
Map position of balancer-5.18
Sequence of primersExtRev:TAGAACCGTTGATGTGTCGT,IntRev:AAACAAGACACCCGGAAGCT,ExtFwd:GCAGTACAACAATCTCCCGT,IntFwd:TTTTCGCTCCTTCCAATCCA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Luke-Glaser S, Pintard L, Tyers M, Peter M.
The AAA-ATPase FIGL-1 controls mitotic progression, and its levels are regulated by the CUL-3MEL-26 E3 ligase in the C. elegans germ line.
J. Cell. Sci. 2007 120(Pt 18) 3179-87 
[ PubMed ID = 17878235 ] [ RRC reference ]

Onitake A, Yamanaka K, Esaki M, Ogura T.
Caenorhabditis elegans fidgetin homolog FIGL-1, a nuclear-localized AAA ATPase, binds to SUMO.
J. Struct. Biol. 2012 179(2) 143-51 
[ PubMed ID = 22575764 ] [ RRC reference ]