Mutants (Isolated)

tm805

Allele Nametm805
Sequence NameT22H2.5a
CGC Namescrm-1
Worm BaseAllele Name tm805
CGC Name scrm-1
Sequence T22H2.5a
Phenotypehomozygous viable
Mutation site1166/1167-ATAATAT-1735/1736 (569 bp deletion + 7 bp insertion)
ChromosomeI
Putative gene structurecomplement(join(772..776, 1008..1053, 1101..1159, 1206..1308, 1715..2017, 2118..2192))
Map position9.53
Balancer
Map position of balancer
Sequence of primersExtFwd:AACCATCGGGGCAGCAGCAT,IntFwd:GCGGAGCTTGCTGTACCTTT,IntRev:CACGGAGCAACAGAGCCCTA,ExtRev:GGTGCTCCACGGAAGCATGA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Nichols ALA, Meelkop E, Linton C, Giordano-Santini R, Sullivan RK, Donato A, Nolan C, Hall DH, Xue D, Neumann B, Hilliard MA.
The Apoptotic Engulfment Machinery Regulates Axonal Degeneration in C. elegans Neurons.
Cell Rep 2016 14(7) 1673-1683 
[ PubMed ID = 26876181 ] [ RRC reference ]

Wang X, Wang J, Gengyo-Ando K, Gu L, Sun CL, Yang C, Shi Y, Kobayashi T, Shi Y, Mitani S, Xie XS, Xue D.
C. elegans mitochondrial factor WAH-1 promotes phosphatidylserine externalization in apoptotic cells through phospholipid scramblase SCRM-1.
Nat. Cell Biol. 2007 9(5) 541-9 
[ PubMed ID = 17401362 ] [ RRC reference ]

Yu H, Aleman-Meza B, Gharib S, Labocha MK, Cronin CJ, Sternberg PW, Zhong W.
Systematic profiling of Caenorhabditis elegans locomotive behaviors reveals additional components in G-protein Gαq signaling.
Proc. Natl. Acad. Sci. U.S.A. 2013 110(29) 11940-5 
[ PubMed ID = 23818641 ] [ RRC reference ]