Home > Mutants (Isolated) > tm797

Mutants (Isolated)

Allele Name		tm797
Allele Type		Normal
Sequence Name		F11D5.3
Gene Name		F11D5.3
Worm Base	Allele Name	tm797
	Gene Name	F11D5.3
	Sequence	F11D5.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. T. Schedl: fertile, normal locomotion.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		19813/19814-20162/20163 (349 bp deletion)
Chromosome		X
Putative gene structure		join(13790..13856, 16299..16404, 17621..17718, 17768..17901, 19471..19618, 19728..20017, 20062..20374, 20428..20695, 20915..20986, 21035..21261, 21311..21440, 21488..21565, 21894..22200, 22251..22406)
Map position		-10.56
Balancer
Map position of balancer
Sequence of primers		IntFwd:CGACATCTTGACCGGGCAAT,ExtFwd:GCTAATAATGACACGGAGCA,IntRev:CTTTCGAGCTACAGGTAAAG,ExtRev:GGAGCACTGGGAGTCTAGGA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Park K, Jayadev R, Payne SG, Kenny-Ganzert IW, Chi Q, Costa DS, Ramos-Lewis W, Thendral SB, Sherwood DR. Reciprocal discoidin domain receptor signaling strengthens integrin adhesion to connect adjacent tissues. Elife 2023 12   [ PubMed ID = 37405383 ] [ RRC reference ] Shimizu T, Kato Y, Sakai Y, Hisamoto N, Matsumoto K. N-Glycosylation of the Discoidin Domain Receptor Is Required for Axon Regeneration in Caenorhabditis elegans. Genetics 2019 213(2) 491-500  [ PubMed ID = 31371405 ] [ RRC reference ] Hisamoto N, Nagamori Y, Shimizu T, Pastuhov SI, Matsumoto K. The C. elegans Discoidin Domain Receptor DDR-2 Modulates the Met-like RTK-JNK Signaling Pathway in Axon Regeneration. PLoS Genet 2016 12(12) e1006475  [ PubMed ID = 27984580 ] [ RRC reference ] Unsoeld T, Park JO, Hutter H. Discoidin domain receptors guide axons along longitudinal tracts in C. elegans. Dev Biol 2013 374(1) 142-52  [ PubMed ID = 23147028 ] [ RRC reference ]