Allele Name | tm796 |
Sequence Name | T17E9.2a |
CGC Name | nmt-1 |
Worm Base | Allele Name |
tm796
|
CGC Name |
nmt-1
|
Sequence |
T17E9.2a
|
Phenotype | homozygous viable. Dr. M. Nonet: sterile, animals grow up normally. most are sterile and a few lay a few progeny. granddaughters are completely sterile. |
Mutation site | 7324/7325-7817/7819 (493 bp deletion) |
Chromosome | III |
Putative gene structure | complement(join(6015..6341, 6395..7188, 7269..7401, 7450..7548)) |
Map position | -1.42 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtRev:AATGTTGCGCAGAGAACTGA,ExtFwd:CTTGGCTTCATGTCGGCGCA,IntRev:CTGAAAACGCCAGTTGACAT,IntFwd:GCGCACTTCCAGTTGTACAA |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Galvin BD, Li Z, Villemaine E, Poole CB, Chapman MS, Pollastri MP, Wyatt PG, Carlow CK. A target repurposing approach identifies N-myristoyltransferase as a new candidate drug target in filarial nematodes. PLoS Negl Trop Dis 2014 8(9) e3145
[ PubMed ID = 25188325 ]
[ RRC reference ]
|
C. elegans Deletion Mutant Consortium. large-scale screening for targeted knockouts in the Caenorhabditis elegans genome. G3 (Bethesda) 2012 2(11) 1415-25
[ PubMed ID = 23173093 ]
[ RRC reference ]
|
|