Mutants (Isolated)

tm794

Allele Nametm794
Sequence NameC16C10.7
CGC Namernf-5
Worm BaseAllele Name tm794
CGC Name rnf-5
Sequence C16C10.7
Phenotypehomozygous viable. Dr. Z. Ronai: J. Cell Biol. 165, 857-867 (2004).
Mutation site22868/22869-23515/23516 (647 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(21889..22010, 22436..22706, 23264..23510, 24112..24179))
Map position-3.74
Balancer
Map position of balancer
Sequence of primersIntRev:CAATGGCGTCGGAGACGAAA,IntFwd:TGTCCACGGGGTCCTGAAAA,ExtFwd:TGATCCCGGTGCAGCTGATT,ExtRev:ATTTCAGAGTTCGGAGCCAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Broday L, Kolotuev I, Didier C, Bhoumik A, Podbilewicz B, Ronai Z.
The LIM domain protein UNC-95 is required for the assembly of muscle attachment structures and is regulated by the RING finger protein RNF-5 in C. elegans.
J. Cell Biol. 2004 165(6) 857-67 
[ PubMed ID = 15210732 ] [ RRC reference ]

Kovacevic I, Ho R, Cram EJ.
CCDC-55 is required for larval development and distal tip cell migration in Caenorhabditis elegans.
Mech. Dev. 2012 128(11-12) 548-59 
[ PubMed ID = 22285439 ] [ RRC reference ]

Kuang E, Okumura CY, Sheffy-Levin S, Varsano T, Shu VC, Qi J, Niesman IR, Yang HJ, López-Otín C, Yang WY, Reed JC, Broday L, Nizet V, Ronai ZA.
Regulation of ATG4B stability by RNF5 limits basal levels of autophagy and influences susceptibility to bacterial infection.
PLoS Genet. 2012 8(10) e1003007 
[ PubMed ID = 23093945 ] [ RRC reference ]

Darom A, Bening-Abu-Shach U, Broday L.
RNF-121 is an endoplasmic reticulum-membrane E3 ubiquitin ligase involved in the regulation of beta-integrin.
Mol. Biol. Cell 2010 21(11) 1788-98 
[ PubMed ID = 20357004 ] [ RRC reference ]

Zaidel-Bar R, Miller S, Kaminsky R, Broday L.
Molting-specific downregulation of C. elegans body-wall muscle attachment sites: the role of RNF-5 E3 ligase.
Biochem. Biophys. Res. Commun. 2010 395(4) 509-14 
[ PubMed ID = 20385102 ] [ RRC reference ]

Jablonski AM, Lamitina T, Liachko NF, Sabatella M, Lu J, Zhang L, Ostrow LW, Gupta P, Wu CY, Doshi S, Mojsilovic-Petrovic J, Lans H, Wang J, Kraemer B, Kalb RG.
Loss of RAD-23 Protects Against Models of Motor Neuron Disease by Enhancing Mutant Protein Clearance.
J. Neurosci. 2015 35(42) 14286-306 
[ PubMed ID = 26490867 ] [ RRC reference ]