Mutants (Isolated)

tm789

Allele Nametm789
Sequence NameW02A2.1
CGC Namefat-2
Worm BaseAllele Name tm789
CGC Name fat-2
Sequence W02A2.1
Phenotypehomozygous viable. Dr. K. Sakamoto: J. Biochem 144, 149 (2008). Dr. S. Boulton: does not interact with brc-1 (tm1145) or brd-1 (dw1).
Mutation site1701/1702-2107/2108 (406 bp deletion)
ChromosomeIV
Putative gene structurejoin(830..1480, 2149..2274, 2875..3228)
Map position8.53
Balancer
Map position of balancer
Sequence of primersExtFwd:GTGATGTGATGCTGGGAAGT,IntRev:TCTCACTCCCTAACTCGGAA,IntFwd:GCATACATTGGCCCAATGCA,ExtRev:AACACGGCTCCCACTCGCTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Horikawa M, Sakamoto K.
Polyunsaturated fatty acids are involved in regulatory mechanism of fatty acid homeostasis via daf-2/insulin signaling in Caenorhabditis elegans.
Mol. Cell. Endocrinol. 2010 323(2) 183-92 
[ PubMed ID = 20226839 ] [ RRC reference ]