Mutants (Isolated)

tm7788

Allele Nametm7788
Sequence NameF43C1.1
CGC NameF43C1.1
Worm BaseAllele Name tm7788
CGC Name F43C1.1
Sequence F43C1.1
Phenotypehomozygous viable
Mutation site4640/4641-4771/4772 (131 bp deletion)
ChromosomeIII
Putative gene structurejoin(1958..2204, 2321..2386, 2440..2672, 3032..3325, 3378..3602, 4026..4107, 4154..4310, 4364..4519, 4565..4643, 5193..5471, 5540..5769, 5990..6104, 6155..6230, 6437..6533, 6851..7148, 7293..7441, 7774..8101)
Map position-3.66
Balancer
Map position of balancer
Sequence of primersExtRev:ACCATAGGCACGCTTGTAGG,ExtFwd:GATTGGATATCAGATTGCCC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
D'Amora DR, Hu Q, Pizzardi M, Kubiseski TJ.
BRAP-2 promotes DNA damage induced germline apoptosis in C. elegans through the regulation of SKN-1 and AKT-1.
Cell Death Differ 2018 25(7) 1276-1288 
[ PubMed ID = 29358669 ] [ RRC reference ]