Mutants (Isolated)

tm773

Allele Nametm773
Sequence NameF32G8.6
CGC Namecat-4
Worm BaseAllele Name tm773
CGC Name cat-4
Sequence F32G8.6
Phenotypehomozygous viable
Mutation site17232/17233-17882/17883 (650 bp deletion)
ChromosomeV
Putative gene structurejoin(17476..17638, 18206..18301, 18349..18546, 18605..18819)
Map position2.6
Balancer
Map position of balancer
Sequence of primersExtFwd:GAAGGAATGGCGGAAAACGA,ExtRev:GTGGTGGAAGCATTGATCTT,IntRev:CCATACACATGTGACTAGCT,IntFwd:GATGTATGGGACGACGTCTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Baker RH, Britton C, Roberts B, Loer CM, Matthews JB, Nisbet AJ.
Melanisation of Teladorsagia circumcincta larvae exposed to sunlight: a role for GTP-cyclohydrolase in nematode survival.
Int. J. Parasitol. 2012 42(10) 887-91 
[ PubMed ID = 22884628 ] [ RRC reference ]

Loer CM, Calvo AC, Watschinger K, Werner-Felmayer G, O'Rourke D, Stroud D, Tong A, Gotenstein JR, Chisholm AD, Hodgkin J, Werner ER, Martinez A.
Cuticle integrity and biogenic amine synthesis in Caenorhabditis elegans require the cofactor tetrahydrobiopterin (BH4).
Genetics 2015 200(1) 237-53 
[ PubMed ID = 25808955 ] [ RRC reference ]

Chuang M, Hsiao TI, Tong A, Xu S, Chisholm AD.
DAPK interacts with Patronin and the microtubule cytoskeleton in epidermal development and wound repair.
Elife 2016 5  
[ PubMed ID = 27661253 ] [ RRC reference ]