Home > Mutants (Isolated) > tm773

Mutants (Isolated)

Allele Name		tm773
Allele Type		Normal
Sequence Name		F32G8.6
Gene Name		cat-4
Worm Base	Allele Name	tm773
	Gene Name	cat-4
	Sequence	F32G8.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		17232/17233-17882/17883 (650 bp deletion)
Chromosome		V
Putative gene structure		join(17476..17638, 18206..18301, 18349..18546, 18605..18819)
Map position		2.6
Balancer
Map position of balancer
Sequence of primers		ExtFwd:GAAGGAATGGCGGAAAACGA,ExtRev:GTGGTGGAAGCATTGATCTT,IntRev:CCATACACATGTGACTAGCT,IntFwd:GATGTATGGGACGACGTCTT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Chuang M, Hsiao TI, Tong A, Xu S, Chisholm AD. DAPK interacts with Patronin and the microtubule cytoskeleton in epidermal development and wound repair. Elife 2016 5   [ PubMed ID = 27661253 ] [ RRC reference ] Baker RH, Britton C, Roberts B, Loer CM, Matthews JB, Nisbet AJ. Melanisation of Teladorsagia circumcincta larvae exposed to sunlight: a role for GTP-cyclohydrolase in nematode survival. Int J Parasitol 2012 42(10) 887-91  [ PubMed ID = 22884628 ] [ RRC reference ] Loer CM, Calvo AC, Watschinger K, Werner-Felmayer G, O'Rourke D, Stroud D, Tong A, Gotenstein JR, Chisholm AD, Hodgkin J, Werner ER, Martinez A. Cuticle integrity and biogenic amine synthesis in Caenorhabditis elegans require the cofactor tetrahydrobiopterin (BH4). Genetics 2015 200(1) 237-53  [ PubMed ID = 25808955 ] [ RRC reference ]