Mutants (Isolated)

tm764

Allele Nametm764
Sequence NameF18C5.2
CGC Namewrn-1
Worm BaseAllele Name tm764
CGC Name wrn-1
Sequence F18C5.2
Phenotypehomozygous viable. Dr. S. Ahmed: Not hypersensitive to ionizing radiation. Dr. H-S. Koo: hypersensitive to ionizing radiation at L1 stage.
Mutation site9579/9580-10035/10036 (456 bp deletion)
ChromosomeII
Putative gene structurejoin(8186..8300, 8357..8413, 8461..9238, 9284..9354, 9406..9786, 10106..10191, 10498..10580, 10631..10847, 10897..11222, 11270..11369, 11419..11543, 11595..11727, 11772..11864, 11912..12071, 12121..12356)
Map position-0.13
Balancer
Map position of balancer
Sequence of primersExtFwd:GATGACGATCTACCATCTAC,ExtRev:TCCAACGGTTGTCAGAACCA,IntFwd:CGCCCGGGATCTGTGAATGA,IntRev:CTCGAGTTGTCTTAGCATCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ahmed S.
Uncoupling of pathways that promote postmitotic life span and apoptosis from replicative immortality of Caenorhabditis elegans germ cells.
Aging Cell 2006 5(6) 559-63 
[ PubMed ID = 17081157 ] [ RRC reference ]

Lee SJ, Gartner A, Hyun M, Ahn B, Koo HS.
The Caenorhabditis elegans Werner syndrome protein functions upstream of ATR and ATM in response to DNA replication inhibition and double-strand DNA breaks.
PLoS Genet. 2010 6(1) e1000801 
[ PubMed ID = 20062519 ] [ RRC reference ]