Mutants (Isolated)

tm761

Allele Nametm761
Sequence NameC16C2.2
CGC Nameeat-16
Worm BaseAllele Name tm761
CGC Name eat-16
Sequence C16C2.2
Phenotypelethal or sterile. Dr. R. Horvitz: could not recover mutants from heterozygotes.
Mutation site10793/10794-AAAAATTTGGTTTTTA-12018/12019 (1225 bp deletion + 16 bp insertion)
ChromosomeI
Putative gene structurejoin(9906..9926, 9977..10096, 10207..10290, 10355..10448, 10493..10571, 10949..11245, 11383..11496, 11544..12054, 12101..12186, 12504..12519)
Map position3.87
BalancerhT2 [qIs48]
Map position of balancer
Sequence of primersIntFwd:CAGCAATTGATAGCTCTCGT,ExtFwd:CCTCATGCCATCACCGGTCA,ExtRev:ACTTGACCCCATGAGCCTGT,IntRev:TGGCAGCGAGTCGGACGATA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Huang H, Zhu CT, Skuja LL, Hayden DJ, Hart AC.
Genome-Wide Screen for Genes Involved in Caenorhabditis elegans Developmentally Timed Sleep.
G3 (Bethesda) 2017 7(9) 2907-2917 
[ PubMed ID = 28743807 ] [ RRC reference ]

Porter MY, Koelle MR.
RSBP-1 is a membrane-targeting subunit required by the Galpha(q)-specific but not the Galpha(o)-specific R7 regulator of G protein signaling in Caenorhabditis elegans.
Mol. Biol. Cell 2010 21(2) 232-43 
[ PubMed ID = 19923320 ] [ RRC reference ]

Porter MY, Xie K, Pozharski E, Koelle MR, Martemyanov KA.
A conserved protein interaction interface on the type 5 G protein beta subunit controls proteolytic stability and activity of R7 family regulator of G protein signaling proteins.
J. Biol. Chem. 2010 285(52) 41100-12 
[ PubMed ID = 20959458 ] [ RRC reference ]

Krzyzanowski MC, Brueggemann C, Ezak MJ, Wood JF, Michaels KL, Jackson CA, Juang BT, Collins KD, Yu MC, L'etoile ND, Ferkey DM.
The C. elegans cGMP-dependent protein kinase EGL-4 regulates nociceptive behavioral sensitivity.
PLoS Genet. 2013 9(7) e1003619 
[ PubMed ID = 23874221 ] [ RRC reference ]