Mutants (Isolated)

tm759

Allele Nametm759
Sequence NameC49A1.4
CGC Nameeya-1
Worm BaseAllele Name tm759
CGC Name eya-1
Sequence C49A1.4
Phenotypelethal or sterile. Dr. M. Hengartner: no altered germline apoptosis phenotype. Dr. A. Sugimoto: Dev. Biol. in press
Mutation site12849/12850-13390/13391 (541 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(11430..11516, 12928..13298, 13373..13577, 14360..14686, 15519..15646, 15692..15874, 17545..17653))
Map position23.89
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersExtRev:CTCACTGAAACGCCTTCAAA,IntRev:TCAGTTCCTAGAAGGTGACA,ExtFwd:TGTAAAGCTTGTCGAGGTCC,IntFwd:CGTATTGGAGTTGAGTGGCC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Furuya M, Qadota H, Chisholm AD, Sugimoto A.
The C. elegans eyes absent ortholog EYA-1 is required for tissue differentiation and plays partially redundant roles with PAX-6.
Dev. Biol. 2005 286(2) 452-63 
[ PubMed ID = 16154558 ] [ RRC reference ]