Mutants (Isolated)

tm756

Allele Nametm756
Sequence NameT07G12.11
CGC Namezim-3
Worm BaseAllele Name tm756
CGC Name zim-3
Sequence T07G12.11
Phenotypelethal or sterile. Dr. P. Sengupta: dyf+ in all sensory neurons. Dr. A. Dernburg: tm756 has side mutation that causes lethality. Dr. P. Swoboda: dye filling normal.
Mutation site31722/31723-32081/32082 (359 bp deletion)
ChromosomeIV
Putative gene structurejoin(30289..30387, 30451..31172, 31330..31591, 31678..31929, 32010..32203, 32252..32313, 32359..32495)
Map position4.63
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersExtFwd:TAACGGTTGTCGATACGCCT,ExtRev:TATATCTCCGCGGTTTCCCA,IntRev:CGGTTTCCCAATATTTCCGA,IntFwd:CGATACGCCTGAGAACATGT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Phillips CM, Dernburg AF.
A family of zinc-finger proteins is required for chromosome-specific pairing and synapsis during meiosis in C. elegans.
Dev. Cell 2006 11(6) 817-29 
[ PubMed ID = 17141157 ] [ RRC reference ]