Mutants (Isolated)

tm752

Allele Nametm752
Allele TypeNormal
Sequence NameC09D1.1b
Gene Nameunc-89
Worm BaseAllele Name tm752
Gene Name unc-89
Sequence C09D1.1b
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. G. Benian: J. Muscle Res Cell Motii. 26, 435 (2005). Mol. Biol Cell 19, 2424 (2008).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 59474/59475-60005/60006 (531 bp deletion)
ChromosomeI
Putative gene structurejoin(10843..10892, 11579..11852, 11897..12033, 13440..13610, 13660..13822, 19750..19931, 19975..20053, 20446..20666, 20970..21052, 22200..22337, 22915..23025, 23074..23300, 23856..24599, 24922..24990, 25043..25258, 26905..27092, 27406..27889, 28348..28533, 29426..29491, 30341..32194, 33486..33842, 33929..35160, 35216..37076, 37254..37410, 37625..39784, 39870..45934, 45985..46228, 46283..46612, 48488..48591, 50203..50477, 50576..51660, 52127..52239, 52345..52513, 52974..53073, 54475..54666, 56886..57242, 57352..57616, 57964..58250, 58774..58895, 59015..59418, 59975..60175, 61606..62133, 62407..62728, 63104..63888, 64245..64573, 64632..64850, 64897..65136, 65278..65377)
Map position-1.73
Balancer
Map position of balancer
Sequence of primersIntFwd:TGCAGTCCATTCGATAGTGT,ExtFwd:TGCCACCCAGTCTGATCCTT,IntRev:CTGGAATCAAGAGACCTTGT,ExtRev:CAGAGTAGGTGACCTTTGCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Qadota H, Matsunaga Y, Bagchi P, Lange KI, Carrier KJ, Pols WV, Swartzbaugh E, Wilson KJ, Srayko M, Pallas DC, Benian GM.
Protein phosphatase 2A is crucial for sarcomere organization in Caenorhabditis elegans striated muscle.
Mol Biol Cell 2018 29(17) 2084-2097 
[ PubMed ID = 29949401 ] [ RRC reference ]

Qadota H, Mayans O, Matsunaga Y, McMurry JL, Wilson KJ, Kwon GE, Stanford R, Deehan K, Tinley TL, Ngwa VM, Benian GM.
The SH3 domain of UNC-89 (obscurin) interacts with paramyosin, a coiled-coil protein, in Caenorhabditis elegans muscle.
Mol Biol Cell 2016 27(10) 1606-20 
[ PubMed ID = 27009202 ] [ RRC reference ]

Mok CA, Au V, Thompson OA, Edgley ML, Gevirtzman L, Yochem J, Lowry J, Memar N, Wallenfang MR, Rasoloson D, Bowerman B, Schnabel R, Seydoux G, Moerman DG, Waterston RH.
MIP-MAP: High-Throughput Mapping of Caenorhabditis elegans Temperature-Sensitive Mutants via Molecular Inversion Probes.
Genetics 2017 207(2) 447-463 
[ PubMed ID = 28827289 ] [ RRC reference ]

Wilson KJ, Qadota H, Mains PE, Benian GM.
UNC-89 (obscurin) binds to MEL-26, a BTB-domain protein, and affects the function of MEI-1 (katanin) in striated muscle of Caenorhabditis elegans.
Mol Biol Cell 2012 23(14) 2623-34 
[ PubMed ID = 22621901 ] [ RRC reference ]

Nahabedian JF, Qadota H, Stirman JN, Lu H, Benian GM.
Bending amplitude - a new quantitative assay of C. elegans locomotion: identification of phenotypes for mutants in genes encoding muscle focal adhesion components.
Methods 2012 56(1) 95-102 
[ PubMed ID = 22126736 ] [ RRC reference ]

Xiong G, Qadota H, Mercer KB, McGaha LA, Oberhauser AF, Benian GM.
A LIM-9 (FHL)/SCPL-1 (SCP) complex interacts with the C-terminal protein kinase regions of UNC-89 (obscurin) in Caenorhabditis elegans muscle.
J Mol Biol 2009 386(4) 976-88 
[ PubMed ID = 19244614 ] [ RRC reference ]

Qadota H, McGaha LA, Mercer KB, Stark TJ, Ferrara TM, Benian GM.
A novel protein phosphatase is a binding partner for the protein kinase domains of UNC-89 (Obscurin) in Caenorhabditis elegans.
Mol Biol Cell 2008 19(6) 2424-32 
[ PubMed ID = 18337465 ] [ RRC reference ]

Ferrara TM, Flaherty DB, Benian GM.
Titin/connectin-related proteins in C. elegans: a review and new findings.
J Muscle Res Cell Motil 2005 26(6-8) 435-47 
[ PubMed ID = 16453163 ] [ RRC reference ]