Home > Mutants (Isolated) > tm7516

Mutants (Isolated)

Allele Name		tm7516
Allele Type		Normal
Sequence Name		F55A12.4
Gene Name		dhs-2
Worm Base	Allele Name	tm7516
	Gene Name	dhs-2
	Sequence	F55A12.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		16729/16730-16887/16888 (158 bp deletion)
Chromosome		I
Putative gene structure		join(15314..15371, 15484..15663, 15714..15787, 16152..16293, 16611..16764, 16817..17012, 17237..17312, 17783..17918, 17975..18065)
Map position		-0.06
Balancer
Map position of balancer
Sequence of primers		ExtFwd:GTGCTCGGAGAGCTACCTAT,ExtRev:CCAGAGAACTCAGTCATAAC
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Cornwell A, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV. The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction. bioRxiv 2023    [ PubMed ID = 38045350 ] [ RRC reference ] Radeke LJ, Herman MA. Identification and characterization of differentially expressed genes in Caenorhabditis elegans in response to pathogenic and nonpathogenic Stenotrophomonas maltophilia. BMC Microbiol 2020 20(1) 170  [ PubMed ID = 32560629 ] [ RRC reference ]