Mutants (Isolated)

tm750

Allele Nametm750
Sequence NameC07H6.1
CGC Namelig-4
Worm BaseAllele Name tm750
CGC Name lig-4
Sequence C07H6.1
Phenotypehomozygous viable. Dr. S. Ahmed: Genetics 173, 1301-1317 (2006). Dr. J-L. Bessereau: EMBO J. 26, 170 (2007). Dr. H-S. Koo: the germ cells are slightly (10%) resistent to ionizing radiation (gamma rays) and DNA crosslinking.
Mutation site38120/38121-39372/39373 (1252 bp deletion)
ChromosomeIII
Putative gene structurejoin(37728..37848, 37901..38200, 38248..38561, 38611..38733, 38996..39209, 39255..39405, 39456..39551, 39601..40012, 40099..40213, 40261..40407, 40774..40970)
Map position-0.7
Balancer
Map position of balancer
Sequence of primersExtRev:ATTTGGCACGTTTCAGACGA,ExtFwd:AGTTCGACATGGGACCGACT,IntFwd:GTTGGCAAGCTTTATGGCAA,IntRev:CGAACAGGAGCTGCTGTAAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Robert V, Bessereau JL.
Targeted engineering of the Caenorhabditis elegans genome following Mos1-triggered chromosomal breaks.
EMBO J. 2007 26(1) 170-83 
[ PubMed ID = 17159906 ] [ RRC reference ]

Clejan I, Boerckel J, Ahmed S.
Developmental modulation of nonhomologous end joining in Caenorhabditis elegans.
Genetics 2006 173(3) 1301-17 
[ PubMed ID = 16702421 ] [ RRC reference ]

Lowden MR, Meier B, Lee TW, Hall J, Ahmed S.
End joining at Caenorhabditis elegans telomeres.
Genetics 2008 180(2) 741-54 
[ PubMed ID = 18780750 ] [ RRC reference ]

Dejima K, Hori S, Iwata S, Suehiro Y, Yoshina S, Motohashi T, Mitani S.
An Aneuploidy-Free and Structurally Defined Balancer Chromosome Toolkit for Caenorhabditis elegans.
Cell Rep 2018 22(1) 232-241 
[ PubMed ID = 29298424 ] [ RRC reference ]