Mutants (Isolated)

tm7401

Allele Nametm7401
Sequence NameK10C8.3
CGC Nameistr-1
Worm BaseAllele Name tm7401
CGC Name istr-1
Sequence K10C8.3
Phenotypehomozygous viable
Mutation site18694/18695-18800/18801 (106 bp deletion)
ChromosomeV
Putative gene structurejoin(16488..16626, 16682..17211, 17693..17882, 18021..18059, 18463..18538, 18588..18714, Z75547.1:1359..1440, Z75547.1:1530..1684)
Map position4.61
Balancer
Map position of balancer
Sequence of primersExtFwd:CTGGTAAAGTTGTCCATCGT,ExtRev:GTTAGCGTTTGTGTGCCTTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Frankel EB, Shankar R, Moresco JJ, Yates JR 3rd, Volkmann N, Audhya A.
Ist1 regulates ESCRT-III assembly and function during multivesicular endosome biogenesis in Caenorhabditis elegans embryos.
Nat Commun 2017 8(1) 1439 
[ PubMed ID = 29129923 ] [ RRC reference ]