Mutants (Isolated)

tm737

Allele Nametm737
Sequence NameT14E8.1
CGC NameT14E8.1
Worm BaseAllele Name tm737
CGC Name T14E8.1
Sequence T14E8.1
Phenotypehomozygous viable. Dr. K. Matsumoto: not sensitive to copper.
Mutation site18597/18598-ATTTTTAT-19243/19244 (646 bp deletion + 8 bp insertion)
ChromosomeX
Putative gene structurejoin(16577..16750, 17388..17469, 17526..17634, 17682..17885, 17931..18181, 18229..18317, 18367..18582, 18627..18733, 18913..19015, 19063..19182, 19228..19416, 19465..19586, 19633..20025, 20269..20450, 20503..20755, 20803..20971, 21038..21204, 21760..21912, 22149..22356)
Map position-2.87
Balancer
Map position of balancer
Sequence of primersExtFwd:AGTCATTAGATTCTGCGCGA,ExtRev:ACCTTGGCCAATAGGATCCA,IntRev:TTGTCAACGCGCAGGTTCTT,IntFwd:GACAGATCAAACTGCAGACT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Pastuhov SI, Fujiki K, Nix P, Kanao S, Bastiani M, Matsumoto K, Hisamoto N.
Endocannabinoid-Goα signalling inhibits axon regeneration in Caenorhabditis elegans by antagonizing Gqα-PKC-JNK signalling.
Nat Commun 2012 3 1136 
[ PubMed ID = 23072806 ] [ RRC reference ]

Hisamoto N, Li C, Yoshida M, Matsumoto K.
The C. elegans HGF/plasminogen-like protein SVH-1 has protease-dependent and -independent functions.
Cell Rep 2014 9(5) 1628-1634 
[ PubMed ID = 25464847 ] [ RRC reference ]

Li C, Hisamoto N, Matsumoto K.
Axon Regeneration Is Regulated by Ets-C/EBP Transcription Complexes Generated by Activation of the cAMP/Ca2+ Signaling Pathways.
PLoS Genet. 2015 11(10) e1005603 
[ PubMed ID = 26484536 ] [ RRC reference ]

Li C, Hisamoto N, Nix P, Kanao S, Mizuno T, Bastiani M, Matsumoto K.
The growth factor SVH-1 regulates axon regeneration in C. elegans via the JNK MAPK cascade.
Nat. Neurosci. 2012 15(4) 551-7 
[ PubMed ID = 22388962 ] [ RRC reference ]