Mutants (Isolated)

tm737

Allele Nametm737
Sequence NameT14E8.1
CGC NameT14E8.1
Worm BaseAllele Name tm737
CGC Name T14E8.1
Sequence T14E8.1
Phenotypehomozygous viable. Dr. K. Matsumoto: not sensitive to copper.
Mutation site18597/18598-ATTTTTAT-19243/19244 (646 bp deletion + 8 bp insertion)
ChromosomeX
Putative gene structurejoin(16577..16750, 17388..17469, 17526..17634, 17682..17885, 17931..18181, 18229..18317, 18367..18582, 18627..18733, 18913..19015, 19063..19182, 19228..19416, 19465..19586, 19633..20025, 20269..20450, 20503..20755, 20803..20971, 21038..21204, 21760..21912, 22149..22356)
Map position-2.87
Balancer
Map position of balancer
Sequence of primersExtFwd:AGTCATTAGATTCTGCGCGA,ExtRev:ACCTTGGCCAATAGGATCCA,IntRev:TTGTCAACGCGCAGGTTCTT,IntFwd:GACAGATCAAACTGCAGACT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Shimizu T, Pastuhov SI, Hanafusa H, Sakai Y, Todoroki Y, Hisamoto N, Matsumoto K.
Caenorhabditis elegans F-Box Protein Promotes Axon Regeneration by Inducing Degradation of the Mad Transcription Factor.
J Neurosci 2021 41(11) 2373-2381 
[ PubMed ID = 33514673 ] [ RRC reference ]

Sakai Y, Hanafusa H, Pastuhov SI, Shimizu T, Li C, Hisamoto N, Matsumoto K.
TDP2 negatively regulates axon regeneration by inducing SUMOylation of an Ets transcription factor.
EMBO Rep 2019 20(10) e47517 
[ PubMed ID = 31393064 ] [ RRC reference ]

Hisamoto N, Shimizu T, Asai K, Sakai Y, Pastuhov SI, Hanafusa H, Matsumoto K.
C. elegans Tensin Promotes Axon Regeneration by Linking the Met-like SVH-2 and Integrin Signaling Pathways.
J Neurosci 2019 39(29) 5662-5672 
[ PubMed ID = 31109965 ] [ RRC reference ]

Hisamoto N, Nagamori Y, Shimizu T, Pastuhov SI, Matsumoto K.
The C. elegans Discoidin Domain Receptor DDR-2 Modulates the Met-like RTK-JNK Signaling Pathway in Axon Regeneration.
PLoS Genet 2016 12(12) e1006475 
[ PubMed ID = 27984580 ] [ RRC reference ]

Hisamoto N, Li C, Yoshida M, Matsumoto K.
The C. elegans HGF/plasminogen-like protein SVH-1 has protease-dependent and -independent functions.
Cell Rep 2014 9(5) 1628-1634 
[ PubMed ID = 25464847 ] [ RRC reference ]

Li C, Hisamoto N, Matsumoto K.
Axon Regeneration Is Regulated by Ets-C/EBP Transcription Complexes Generated by Activation of the cAMP/Ca2+ Signaling Pathways.
PLoS Genet 2015 11(10) e1005603 
[ PubMed ID = 26484536 ] [ RRC reference ]

Pastuhov SI, Fujiki K, Nix P, Kanao S, Bastiani M, Matsumoto K, Hisamoto N.
Endocannabinoid-Goα signalling inhibits axon regeneration in Caenorhabditis elegans by antagonizing Gqα-PKC-JNK signalling.
Nat Commun 2012 3 1136 
[ PubMed ID = 23072806 ] [ RRC reference ]

Li C, Hisamoto N, Nix P, Kanao S, Mizuno T, Bastiani M, Matsumoto K.
The growth factor SVH-1 regulates axon regeneration in C. elegans via the JNK MAPK cascade.
Nat Neurosci 2012 15(4) 551-7 
[ PubMed ID = 22388962 ] [ RRC reference ]