Mutants (Isolated)

tm725

Allele Nametm725
Sequence NameY116A8C.36
CGC Nameitsn-1
Worm BaseAllele Name tm725
CGC Name itsn-1
Sequence Y116A8C.36
Phenotypehomozygous viable. Dr. A. Salcini: aldicarb hypersensitive.
Mutation site220089/220090-220937/220938 (848 bp deletion)
ChromosomeIV
Putative gene structurejoin(219591..219740, 219792..220376, 220860..221357, 221469..221693, 221740..222370, 223152..223522, 224109..224425, 225326..225842)
Map position16.22
Balancer
Map position of balancer
Sequence of primersExtRev:TGATCAACAGCACCCTTCGA,IntFwd:GCACTAATGCGCAGCAATCT,IntRev:TGAGCTGGCGCCTGAGCAAT,ExtFwd:CGGTCACTGCACGAAATGCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Rose S, Malabarba MG, Krag C, Schultz A, Tsushima H, Di Fiore PP, Salcini AE.
Caenorhabditis elegans intersectin: a synaptic protein regulating neurotransmission.
Mol. Biol. Cell 2007 18(12) 5091-9 
[ PubMed ID = 17942601 ] [ RRC reference ]

Wang W, Bouhours M, Gracheva EO, Liao EH, Xu K, Sengar AS, Xin X, Roder J, Boone C, Richmond JE, Zhen M, Egan SE.
ITSN-1 controls vesicle recycling at the neuromuscular junction and functions in parallel with DAB-1.
Traffic 2008 9(5) 742-54 
[ PubMed ID = 18298590 ] [ RRC reference ]