Mutants (Isolated)

tm724

Allele Nametm724
Sequence NameC06A5.7
CGC Nameunc-94
Worm BaseAllele Name tm724
CGC Name unc-94
Sequence C06A5.7
Phenotypelethal or sterile
Mutation site15952/15953-AAAAAAAAAAAAATNGG-16637/16638 (685 bp deletion + 17 bp insertion)
ChromosomeI
Putative gene structurecomplement(join(12870..12895, 13951..14098, 14822..14965, 15131..15226, 15281..15347, 15555..15717, 15799..16120, 16964..16972))
Map position0.66
BalancerhT2 [qIs48]
Map position of balancer
Sequence of primersIntRev:CCACCATTGGGATTGCTGTT,ExtRev:TTGAAGAGAGACCACCCCCA,IntFwd:GGCGAGCACTTGTTAGGTAA,ExtFwd:CTCATATGACACCACGGCGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Cox-Paulson EA, Walck-Shannon E, Lynch AM, Yamashiro S, Zaidel-Bar R, Eno CC, Ono S, Hardin J.
Tropomodulin protects α-catenin-dependent junctional-actin networks under stress during epithelial morphogenesis.
Curr Biol 2012 22(16) 1500-5 
[ PubMed ID = 22771044 ] [ RRC reference ]

Cox-Paulson E, Cannataro V, Gallagher T, Hoffman C, Mantione G, Mcintosh M, Silva M, Vissichelli N, Walker R, Simske J, Ono S, Hoops H.
The minus-end actin capping protein, UNC-94/tropomodulin, regulates development of the Caenorhabditis elegans intestine.
Dev Dyn 2014 243(6) 753-64 
[ PubMed ID = 24677443 ] [ RRC reference ]

Yamashiro S, Cox EA, Baillie DL, Hardin JD, Ono S.
Sarcomeric actin organization is synergistically promoted by tropomodulin, ADF/cofilin, AIP1 and profilin in C. elegans.
J Cell Sci 2008 121(Pt 23) 3867-77 
[ PubMed ID = 18984629 ] [ RRC reference ]