Mutants (Isolated)

tm723

Allele Nametm723
Sequence NameF35E8.11
CGC Namecdr-1
Worm BaseAllele Name tm723
CGC Name cdr-1
Sequence F35E8.11
Phenotypehomozygous viable
Mutation site17345/17346-18207/18208 (862 bp deletion)
ChromosomeV
Putative gene structurejoin(17378..17479, 17543..17674, 18022..18144, 18194..18261, 18314..18572, 18626..18775)
Map position9.14
Balancer
Map position of balancer
Sequence of primersIntFwd:TAGTCACCCAACAGTACGAA,ExtFwd:TGCTAAACTGCAGTACTGCT,ExtRev:CTGTATTGTTGGTGTGGCGA,IntRev:AGAAGGAGGTCGCCGAAAGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Dong J, Song MO, Freedman JH.
Identification and characterization of a family of Caenorhabditis elegans genes that is homologous to the cadmium-responsive gene cdr-1.
Biochim. Biophys. Acta 2005 1727(1) 16-26 
[ PubMed ID = 15652154 ] [ RRC reference ]

Hall J, Haas KL, Freedman JH.
Role of MTL-1, MTL-2, and CDR-1 in mediating cadmium sensitivity in Caenorhabditis elegans.
Toxicol. Sci. 2012 128(2) 418-26 
[ PubMed ID = 22552775 ] [ RRC reference ]