Mutants (Isolated)

tm699

Allele Nametm699
Sequence NameC12D5.2
CGC Namenhr-152
Worm BaseAllele Name tm699
CGC Name nhr-152
Sequence C12D5.2
Phenotypehomozygous viable
Mutation site20930/20931-21596/21597 (666 bp deletion)
ChromosomeV
Putative gene structurejoin(21093..21134, 21312..21477, 21566..21864, 21905..21990, 22038..22244, 22291..22397, 22484..22746)
Map position0.84
Balancer
Map position of balancer
Sequence of primersExtRev:GGAATATGTGGAGCTGCAAT,IntRev:CGCGATTGGGAAGCATCTAA,IntFwd:CTACACCCACGCGTTTTGTT,ExtFwd:GTATGTGATCCCTCTACAGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sonoda S, Ohta A, Maruo A, Ujisawa T, Kuhara A.
Sperm Affects Head Sensory Neuron in Temperature Tolerance of Caenorhabditis elegans.
Cell Rep 2016 16(1) 56-65 
[ PubMed ID = 27320929 ] [ RRC reference ]