Mutants (Isolated)

tm6979

Allele Nametm6979
Sequence NameY105C5A.1272
CGC NameY105C5A.1272
Worm BaseAllele Name tm6979
CGC Name Y105C5A.1272
Sequence Y105C5A.1272
Phenotypehomozygous viable
Mutation site97819/97820-98297/98298 (478 bp deletion)
ChromosomeIV
Putative gene structurejoin(98046..98069, 98120..98323)
Map position14.24
Balancer
Map position of balancer
Sequence of primersExtFwd:AGAGTGCATGACGACATAAG,IntFwd:TATGCGGTAGAGGGGTGCGA,ExtRev:ACCACTATGGACTTGTGCTT,IntRev:GGACGTACAGATCCTGACAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Lee D, Yang H, Kim J, Brady S, Zdraljevic S, Zamanian M, Kim H, Paik YK, Kruglyak L, Andersen EC, Lee J.
The genetic basis of natural variation in a phoretic behavior.
Nat Commun 2017 8(1) 273 
[ PubMed ID = 28819099 ] [ RRC reference ]