Home > Mutants (Isolated) > tm696

Mutants (Isolated)

Allele Name		tm696
Sequence Name		C14F5.3
CGC Name		tnt-3
Worm Base	Allele Name	tm696
	CGC Name	tnt-3
	Sequence	C14F5.3
Phenotype		homozygous viable
Mutation site		13640/13641-14650/14651 (1010 bp deletion)
Chromosome		X
Putative gene structure		complement(join(8281..8344, 8398..8460, 8936..9069, 10377..10451, 10503..10583, 10731..10826, 10876..11031, 11291..11399, 11487..11590, 11635..11838, 11887..11950, 12011..12097, 12338..12673, 12722..14839, 14927..14964, 16013..16075))
Map position		-0.88
Balancer
Map position of balancer
Sequence of primers		IntFwd:TGAACGGGTGCCTTTTCCTT,IntRev:CTATGTCCGACGAGGAAGAA,ExtFwd:CCAGCTCTTCTCAGACTTGA,ExtRev:TCAGCTGCGCCACACTACTA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Connolly AA, Osterberg V, Christensen S, Price M, Lu C, Chicas-Cruz K, Lockery S, Mains PE, Bowerman B. Caenorhabditis elegans oocyte meiotic spindle pole assembly requires microtubule severing and the calponin homology domain protein ASPM-1. Mol Biol Cell 2014 25(8) 1298-311  [ PubMed ID = 24554763 ] [ RRC reference ]