Mutants (Isolated)

tm696

Allele Nametm696
Sequence NameC14F5.3
CGC Nametnt-3
Worm BaseAllele Name tm696
CGC Name tnt-3
Sequence C14F5.3
Phenotypehomozygous viable
Mutation site13640/13641-14650/14651 (1010 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(8281..8344, 8398..8460, 8936..9069, 10377..10451, 10503..10583, 10731..10826, 10876..11031, 11291..11399, 11487..11590, 11635..11838, 11887..11950, 12011..12097, 12338..12673, 12722..14839, 14927..14964, 16013..16075))
Map position-0.88
Balancer
Map position of balancer
Sequence of primersIntFwd:TGAACGGGTGCCTTTTCCTT,IntRev:CTATGTCCGACGAGGAAGAA,ExtFwd:CCAGCTCTTCTCAGACTTGA,ExtRev:TCAGCTGCGCCACACTACTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Connolly AA, Osterberg V, Christensen S, Price M, Lu C, Chicas-Cruz K, Lockery S, Mains PE, Bowerman B.
Caenorhabditis elegans oocyte meiotic spindle pole assembly requires microtubule severing and the calponin homology domain protein ASPM-1.
Mol Biol Cell 2014 25(8) 1298-311 
[ PubMed ID = 24554763 ] [ RRC reference ]