Mutants (Isolated)

tm6929

Allele Nametm6929
Sequence NameC54H2.1
CGC Namesym-3
Worm BaseAllele Name tm6929
CGC Name sym-3
Sequence C54H2.1
Phenotypehomozygous viable.
Mutation site29537/29538-TTTTTCCGTTTAATGAACATG-30763/30764 (1226 bp deletion + 21 bp insertion)
ChromosomeX
Putative gene structurejoin(29570..29668, 29746..29847, 30295..30408, 30555..30751, 30798..30928, 31426..31564, 31770..31956)
Map position-4.37
Balancer
Map position of balancer
Sequence of primersIntRev:CATCTTGTCGTGGACCGAAC,ExtRev:TCGGATGAGACGATGTTCCT,IntFwd:GCATTTCTCGATCTGCGCTT,ExtFwd:CCGTTGTCCATCCATATGTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Huang H, Zhu Y, Eliot MN, Knopik VS, McGeary JE, Carskadon MA, Hart AC.
Combining Human Epigenetics and Sleep Studies in Caenorhabditis elegans: A Cross-Species Approach for Finding Conserved Genes Regulating Sleep.
Sleep 2017 40(6)  
[ PubMed ID = 28431118 ] [ RRC reference ]