Mutants (Isolated)

tm692

Allele Nametm692
Sequence NameT25B6.7
CGC Namesnf-12
Worm BaseAllele Name tm692
CGC Name snf-12
Sequence T25B6.7
Phenotypehomozygous viable
Mutation site20840/20841-21276/21277 (436 bp deletion)
ChromosomeX
Putative gene structurejoin(19070..19402, 19759..20137, 20185..20473, 20586..20757, 20801..21027, 21078..21172, 21220..21349, 21396..21519, 21565..21744, 21837..22622, 23103..23507)
Map position0.57
Balancer
Map position of balancer
Sequence of primersIntFwd:CACTGGTGGGACCAATTTCA,IntRev:TGGCTCAAGGGAGTCGTCTT,ExtFwd:CTTGAAGACCAAACGCCTCA,ExtRev:GTGGGCTCTCAAATTTACCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Dierking K, Polanowska J, Omi S, Engelmann I, Gut M, Lembo F, Ewbank JJ, Pujol N.
Unusual regulation of a STAT protein by an SLC6 family transporter in C. elegans epidermal innate immunity.
Cell Host Microbe 2011 9(5) 425-35 
[ PubMed ID = 21575913 ] [ RRC reference ]

Labed SA, Omi S, Gut M, Ewbank JJ, Pujol N.
The pseudokinase NIPI-4 is a novel regulator of antimicrobial peptide gene expression.
PLoS ONE 2012 7(3) e33887 
[ PubMed ID = 22470487 ] [ RRC reference ]