Mutants (Isolated)

tm690

Allele Nametm690
Sequence NameC06G4.2
CGC Nameclp-1
Worm BaseAllele Name tm690
CGC Name clp-1
Sequence C06G4.2
Phenotypehomozygous viable. Dr. M. Driscoll: No effect found on necrotic cell death. Dr. N. Tavernarakis: normal development, normal locomotion, normal body size/shape, normal brood size.
Mutation site7031/7032-7655/7656 (624 bp deletion)
ChromosomeIII
Putative gene structurejoin(4799..4874, 5795..5923, 5971..6413, 6456..6614, 6685..6947, 7008..7139, 7514..7983, 8028..8104, 8729..8818, 8865..8987)
Map position-0.45
Balancer
Map position of balancer
Sequence of primersExtFwd:CAATGATATCGGTGGACTCA,IntFwd:TCATCAACAGTATGGGAGGT,IntRev:GGCCTTGACACCAGTCATTT,ExtRev:CAAACCATTCCAGCGGCCTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Galimov ER, Pryor RE, Poole SE, Benedetto A, Pincus Z, Gems D.
Coupling of Rigor Mortis and Intestinal Necrosis during C. elegans Organismal Death.
Cell Rep 2018 22(10) 2730-2741 
[ PubMed ID = 29514100 ] [ RRC reference ]

Joyce PI, Satija R, Chen M, Kuwabara PE.
The atypical calpains: evolutionary analyses and roles in Caenorhabditis elegans cellular degeneration.
PLoS Genet. 2012 8(3) e1002602 
[ PubMed ID = 22479198 ] [ RRC reference ]

Geng X, Harry BL, Zhou Q, Skeen-Gaar RR, Ge X, Lee ES, Mitani S, Xue D.
Hepatitis B virus X protein targets the Bcl-2 protein CED-9 to induce intracellular Ca2+ increase and cell death in Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2012 109(45) 18465-70 
[ PubMed ID = 23091037 ] [ RRC reference ]

Mano I, Driscoll M.
Caenorhabditis elegans glutamate transporter deletion induces AMPA-receptor/adenylyl cyclase 9-dependent excitotoxicity.
J. Neurochem. 2009 108(6) 1373-84 
[ PubMed ID = 19054279 ] [ RRC reference ]

Kourtis N, Nikoletopoulou V, Tavernarakis N.
Small heat-shock proteins protect from heat-stroke-associated neurodegeneration.
Nature 2012 490(7419) 213-8 
[ PubMed ID = 22972192 ] [ RRC reference ]