Mutants (Isolated)

tm6877

Allele Nametm6877
Sequence NameF46B3.18
CGC Namettr-57
Worm BaseAllele Name tm6877
CGC Name ttr-57
Sequence F46B3.18
Phenotypehomozygous viable.
Mutation site8957/8958-9256/9257 (299 bp deletion)
ChromosomeV
Putative gene structurejoin(9168..9255, 9453..9532, 9579..9716, 10242..10343)
Map position25.02
Balancer
Map position of balancer
Sequence of primersIntFwd:CGTCGCTGCCGGCGTTATTT,ExtFwd:CGGCGGCACAAGCCTTATTT,IntRev:CGCGTACAGAATTGGTGACA,ExtRev:GAACGATGGCTCACAATAGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Hisamoto N, Tsuge A, Pastuhov SI, Shimizu T, Hanafusa H, Matsumoto K.
Phosphatidylserine exposure mediated by ABC transporter activates the integrin signaling pathway promoting axon regeneration.
Nat Commun 2018 9(1) 3099 
[ PubMed ID = 30082731 ] [ RRC reference ]