Mutants (Isolated)

tm6845

Allele Nametm6845
Sequence NameB0336.5
CGC NameB0336.5
Worm BaseAllele Name tm6845
CGC Name B0336.5
Sequence B0336.5
Phenotypehomozygous viable.
Mutation site6154/6155-6602/6603 (448 bp deletion)
ChromosomeIII
Putative gene structurejoin(5991..6047, 6096..6191, 6241..6556, 6631..6767)
Map position-1.45
Balancer
Map position of balancer
Sequence of primersExtFwd:ATTAATGAGGGCGTGGTCAC,IntFwd:GCGCTTTTTCGCAAGTGGTA,ExtRev:AGTGCCTGACCCAGTGTGGT,IntRev:GGTAAAGAGCGTATGACGAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mutlu B, Chen HM, Moresco JJ, Orelo BD, Yang B, Gaspar JM, Keppler-Ross S, Yates JR 3rd, Hall DH, Maine EM, Mango SE.
Regulated nuclear accumulation of a histone methyltransferase times the onset of heterochromatin formation in C. elegans embryos.
Sci Adv 2018 4(8) eaat6224 
[ PubMed ID = 30140741 ] [ RRC reference ]