Home > Mutants (Isolated) > tm684

Mutants (Isolated)

Allele Name		tm684
Allele Type		Normal
Sequence Name		C05D9.5
Gene Name		ife-4
Worm Base	Allele Name	tm684
	Gene Name	ife-4
	Sequence	C05D9.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. N. Tavernarakis: normal development, normal locomotion, normal body size/shape, less progeny at 25C, Egl at 25C, freequent bagging.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		4570/4571-5361/5362 (791 bp deletion)
Chromosome		X
Putative gene structure		join(3196..3258, 3549..3729, 4212..4449, 4868..5024)
Map position		-18.6
Balancer
Map position of balancer
Sequence of primers		ExtRev:ATTCGGATAACTCAGGTGCG,ExtFwd:CGGCTGGCGATATTTCACCT,IntFwd:CCCGGGAGCTTATCCCACTT,IntRev:GTCGACTTTTGGTTATGGAC
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Ou HL, Schumacher B. Evaluating DNA damage response through immunofluorescence staining of primordial germ cells in Caenorhabditis elegans L1 larva. STAR Protoc 2021 2(2) 100441  [ PubMed ID = 33899022 ] [ RRC reference ] Ou HL, Kim CS, Uszkoreit S, Wickström SA, Schumacher B. Somatic Niche Cells Regulate the CEP-1/p53-Mediated DNA Damage Response in Primordial Germ Cells. Dev Cell 2019 50(2) 167-183.e8  [ PubMed ID = 31336098 ] [ RRC reference ]