Home > Mutants (Isolated) > tm6807

Mutants (Isolated)

Allele Name		tm6807
Allele Type		Normal
Sequence Name		C55A6.7
Gene Name		C55A6.7
Worm Base	Allele Name	tm6807
	Gene Name	C55A6.7
	Sequence	C55A6.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		22065/22066-22453/22454 (388 bp deletion)
Chromosome		V
Putative gene structure		complement(join(22092..22193, 22241..22765, 22913..23041))
Map position		3.19
Balancer
Map position of balancer
Sequence of primers		ExtFwd:CTTTTAGGTCCCCATATCTG,IntRev:GTGGCAGTTCATCACGCTGT,IntFwd:AGGTCCCCATATCTGATTGT,ExtRev:TCCCCGTTCGCAACCAACAC
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Radeke LJ, Herman MA. Identification and characterization of differentially expressed genes in Caenorhabditis elegans in response to pathogenic and nonpathogenic Stenotrophomonas maltophilia. BMC Microbiol 2020 20(1) 170  [ PubMed ID = 32560629 ] [ RRC reference ]