Home > Mutants (Isolated) > tm6801

Mutants (Isolated)

Allele Name		tm6801
Allele Type		Normal
Sequence Name		C15C8.3
Gene Name		asp-10
Worm Base	Allele Name	tm6801
	Gene Name	asp-10
	Sequence	C15C8.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		9732/9733-C-9971/9972(239bp deletion + 1 bp insertion)
Chromosome		V
Putative gene structure		join(9115..9185, 9228..9507, 9555..9631, 9677..9812, 9931..10262, 10314..10427, 10876..11152)
Map position		4.62
Balancer
Map position of balancer
Sequence of primers		ExtRev:GCAAGGCCAAGTCTTCCGCT,IntFwd:GCCAGTCTAAGCATCGGTTC,IntRev:CATGTACGTGGCAATAGGCA,ExtFwd:GAACCACTGACGCTTGCCAG
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Gaeta AL, Willicott K, Willicott CW, McKay LE, Keogh CM, Altman TJ, Kimble LC, Yarbrough AL, Caldwell KA, Caldwell GA. Mechanistic impacts of bacterial diet on dopaminergic neurodegeneration in a Caenorhabditis elegans α-synuclein model of Parkinson's disease. iScience 2023 26(6) 106859  [ PubMed ID = 37260751 ] [ RRC reference ] Min H, Lee YU, Shim YH, Kawasaki I. Autophagy of germ-granule components, PGL-1 and PGL-3, contributes to DNA damage-induced germ cell apoptosis in C. elegans. PLoS Genet 2019 15(5) e1008150  [ PubMed ID = 31125345 ] [ RRC reference ] Sinclair J, Pinter K, Samuel T, Beardsley S, Yuan X, Zhang J, Meng K, Yun S, Krause M, Hamza I. Inter-organ signalling by HRG-7 promotes systemic haem homeostasis. Nat Cell Biol 2017 19(7) 799-807  [ PubMed ID = 28581477 ] [ RRC reference ]