Mutants (Isolated)

tm678

Allele Nametm678
Sequence NameB0041.7
CGC Namexnp-1
Worm BaseAllele Name tm678
CGC Name xnp-1
Sequence B0041.7
Phenotypehomozygous viable. Dr. J. Ewbank: Dev. Biol. 278, 49 (2005), Dr. D. Fay: Dev. Biol. 273, 335 (2004).
Mutation site27232/27233-27905/27906 (673 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(23009..23158, 23264..24062, 24581..24814, 24875..25572, 26090..26265, 26324..26602, 26655..27655, 27721..28287, 28342..28482, 28543..28577))
Map position-1.02
Balancer
Map position of balancer
Sequence of primersExtRev:CTAATGAGAGTTGGTGTCAG,IntFwd:GGTGAGCACACGATAATCTT,ExtFwd:GCTTTGGTGGAATCGCTTCG,IntRev:AGTCGGAGGATTCCGAGTAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Bender AM, Wells O, Fay DS.
lin-35/Rb and xnp-1/ATR-X function redundantly to control somatic gonad development in C. elegans.
Dev. Biol. 2004 273(2) 335-49 
[ PubMed ID = 15328017 ] [ RRC reference ]

Chesney MA, Kidd AR 3rd, Kimble J.
gon-14 functions with class B and class C synthetic multivulva genes to control larval growth in Caenorhabditis elegans.
Genetics 2006 172(2) 915-28 
[ PubMed ID = 16322520 ] [ RRC reference ]

Cardoso C, Couillault C, Mignon-Ravix C, Millet A, Ewbank JJ, Font├ęs M, Pujol N.
XNP-1/ATR-X acts with RB, HP1 and the NuRD complex during larval development in C. elegans.
Dev. Biol. 2005 278(1) 49-59 
[ PubMed ID = 15649460 ] [ RRC reference ]

Cox-Paulson EA, Grana TM, Harris MA, Batzli JM.
Studying human disease genes in Caenorhabditis elegans: a molecular genetics laboratory project.
CBE Life Sci Educ 2012 11(2) 165-79 
[ PubMed ID = 22665589 ] [ RRC reference ]

Lans H, Marteijn JA, Schumacher B, Hoeijmakers JH, Jansen G, Vermeulen W.
Involvement of global genome repair, transcription coupled repair, and chromatin remodeling in UV DNA damage response changes during development.
PLoS Genet. 2010 6(5) e1000941 
[ PubMed ID = 20463888 ] [ RRC reference ]